ID: 1032786937

View in Genome Browser
Species Human (GRCh38)
Location 7:135208430-135208452
Sequence CTGTGCATGAAACGTGTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032786937_1032786940 -6 Left 1032786937 7:135208430-135208452 CCGGGAACACGTTTCATGCACAG 0: 1
1: 0
2: 0
3: 6
4: 111
Right 1032786940 7:135208447-135208469 GCACAGAGAGGGTACTCTCAAGG No data
1032786937_1032786941 2 Left 1032786937 7:135208430-135208452 CCGGGAACACGTTTCATGCACAG 0: 1
1: 0
2: 0
3: 6
4: 111
Right 1032786941 7:135208455-135208477 AGGGTACTCTCAAGGCTGCCCGG 0: 1
1: 0
2: 0
3: 8
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032786937 Original CRISPR CTGTGCATGAAACGTGTTCC CGG (reversed) Intronic
901615224 1:10534145-10534167 CTGTGTGTGACACGTGTACCAGG - Intronic
907392832 1:54169499-54169521 CTGAGCATGAACTGTGTTCCAGG - Intronic
907719072 1:56954490-56954512 CTGTCCATGGGACGTGTTCCTGG + Intronic
909617562 1:77628886-77628908 CTGTGCTAGAAACGTTCTCCAGG - Intronic
912100346 1:106195867-106195889 CAGTGCATGAAACTTTCTCCAGG - Intergenic
920508924 1:206536485-206536507 CCGTGCAAGAAACATGGTCCAGG + Intronic
923029205 1:230233937-230233959 CTGTGGAGGAAATTTGTTCCCGG - Intronic
924627954 1:245711402-245711424 CAGTGAATGAAACAGGTTCCAGG + Intergenic
1065770919 10:29077748-29077770 CTGTTAATGAAAGGGGTTCCAGG + Intergenic
1067067928 10:43113968-43113990 CTGACCTTGAAATGTGTTCCTGG - Intronic
1067244751 10:44530026-44530048 CTGTGTAGGAAGCGTGGTCCTGG + Intergenic
1070400837 10:76052395-76052417 CTGTGGTTGTAAGGTGTTCCTGG + Intronic
1071692882 10:87841197-87841219 CTGTGAATGAACCTTGTTCCTGG + Intronic
1076607653 10:131700046-131700068 CTGAGCATGAAACTTGCTTCTGG - Intergenic
1079883127 11:25951555-25951577 CTGTGGAAAAAATGTGTTCCAGG + Intergenic
1084488658 11:69465738-69465760 CTGGGCATGAAAAGTTTTTCAGG + Intergenic
1084692939 11:70737455-70737477 CTGTGCCTGGCACGTGTTTCTGG - Intronic
1085444144 11:76589542-76589564 CAGTGCATGGCACGTGTTCCAGG - Intergenic
1088827434 11:113507640-113507662 CTGTGCAAGAAACATGGTGCTGG - Intergenic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1093980336 12:25468861-25468883 CAGTGCATGTAAAGTGTGCCTGG + Intronic
1095322657 12:40847809-40847831 TTTTGCATGAAACCTGTCCCTGG - Intronic
1100283955 12:93146436-93146458 CTATGTAAGAAACATGTTCCTGG + Intergenic
1100596148 12:96073749-96073771 GTGTGCATGAAATGAGTCCCTGG - Intergenic
1102417334 12:112775362-112775384 CTGTGCATGTACCATGTGCCAGG + Intronic
1104760856 12:131296926-131296948 CTGTGCATGAACCCTGGGCCTGG - Intergenic
1104818920 12:131663866-131663888 CTGTGCATGAACCCTGGGCCTGG + Intergenic
1106474316 13:30084326-30084348 CTTTCCATGAAACGAGTGCCTGG + Intergenic
1113960492 13:114123140-114123162 CTGTGCAGGACACATGTTTCCGG - Intronic
1114998843 14:28395720-28395742 CTGTGCATGAAACATTCTCTAGG - Intergenic
1117328952 14:54693968-54693990 GTGTGGGGGAAACGTGTTCCAGG + Intronic
1120686897 14:87548233-87548255 CTGTGCATTAAACTTCTTTCAGG - Intergenic
1124510637 15:30321411-30321433 CTGCTCATGAAACCTGTTTCTGG + Intergenic
1124732251 15:32209116-32209138 CTGCTCATGAAACCTGTTTCTGG - Intergenic
1127118442 15:55750012-55750034 CTGAGCATAAAATGTGTTTCAGG + Intergenic
1131994534 15:98121346-98121368 CTGTACATGAAACATTTCCCAGG + Intergenic
1133996966 16:10755654-10755676 CTGTGCATGAAATGTGACCAGGG + Intronic
1142716984 17:1752642-1752664 CTTTGAATGGAACGTGTCCCAGG + Exonic
1147193730 17:38751496-38751518 CTGTGCATGCAACACGTTTCAGG - Intergenic
1151203966 17:72491347-72491369 CTGTGCTTGAGACATGTTCTTGG + Intergenic
1154058588 18:11035950-11035972 CTGTGCTTCAAGCATGTTCCAGG - Intronic
1156047183 18:32889904-32889926 CTGTGCATTAACAGTGCTCCCGG - Intergenic
1157540205 18:48496328-48496350 CTTTCCATGAAACGAGTCCCTGG + Intergenic
1160208979 18:76860233-76860255 CTGTGCATGCCACATGTTCTGGG + Intronic
1162729560 19:12710178-12710200 CTGGGCCTTAAACCTGTTCCTGG - Intronic
1163516201 19:17765373-17765395 CTTTGCATGAACCTTGTGCCCGG + Intronic
1165797748 19:38528602-38528624 CCGGGCATGTAACATGTTCCTGG + Exonic
1167726903 19:51221165-51221187 CTGTGCAAGAAATGTGGTGCTGG - Intergenic
926286300 2:11491669-11491691 TTGTTCATGAAAAGTGTTCTTGG + Intergenic
928829534 2:35463396-35463418 CTATGCATGAAACGTGGTTTAGG - Intergenic
930216382 2:48701479-48701501 ATCTGCAGGAAAAGTGTTCCAGG - Intronic
935173863 2:100630949-100630971 CTGTGAATGAAACCTGCCCCGGG + Intergenic
935483396 2:103621386-103621408 CTGTTAATGAAATGTTTTCCAGG - Intergenic
937146552 2:119650622-119650644 CTGAGCATTAAATGTGTGCCAGG + Intronic
942108573 2:172657882-172657904 CTGTGCAAGAAACATGATGCCGG + Intergenic
945517062 2:210775392-210775414 CTGTGCAGGAAACATGATGCTGG - Intergenic
946933321 2:224693594-224693616 ATGTGAATGAAAATTGTTCCTGG - Intergenic
1170486975 20:16828078-16828100 TTGTTCATGAAACGTTTTACTGG - Intergenic
1173671786 20:44804018-44804040 CTGGGCATGAAATGAGATCCTGG - Intronic
1178396195 21:32245931-32245953 CTGTACAGGAAACGTGATGCTGG + Intergenic
1178733966 21:35132006-35132028 ATATGAATGAAACGTGATCCTGG - Intronic
1179420537 21:41232745-41232767 CTGTGCATGAAGCATGTTGCTGG - Intronic
1182780917 22:32866866-32866888 CTCTACATGGAACTTGTTCCAGG + Intronic
1184433023 22:44452724-44452746 CTGTGCCAGAGACTTGTTCCAGG - Intergenic
1184609930 22:45596429-45596451 CTGCGCATGCTACGTGTGCCTGG - Intronic
951059172 3:18184430-18184452 CCATGCATGAAACATGTTACAGG - Intronic
954093286 3:48301810-48301832 CTGGGCATCAACCATGTTCCAGG - Intergenic
956656285 3:71555651-71555673 CAGTGGGTGGAACGTGTTCCAGG + Intronic
961633611 3:128319108-128319130 CTTAACATGAAACATGTTCCAGG - Intronic
963015896 3:140823569-140823591 ATGTGCATGAATAGTGTTCTCGG + Intergenic
971494556 4:27250345-27250367 CTGTGCAGGAAGCATGTTGCTGG + Intergenic
975728259 4:77313525-77313547 TTGTGCATCAAACATGTTGCAGG - Intronic
976142289 4:82004689-82004711 CAGAGCCTGAAATGTGTTCCTGG + Intronic
979412525 4:120396140-120396162 CCCTGCATGAAACGTCTGCCTGG + Intergenic
979712826 4:123801053-123801075 CTGTACATGAAACATTCTCCAGG - Intergenic
984875643 4:184365225-184365247 CTGTACATGAAGCGTGGTGCTGG + Intergenic
1000097503 5:157984771-157984793 CTGTGCATGCATGGTGTGCCAGG - Intergenic
1002097141 5:176838104-176838126 CTTTGCCTGGAACGAGTTCCGGG - Intronic
1005188191 6:23186479-23186501 GTGTGCATGAAAAGTGTAACTGG - Intergenic
1010403450 6:75475026-75475048 CTGTGCAGGAAGCGTGATGCTGG - Intronic
1013167920 6:107610323-107610345 CTGGCCATGAAACGTCTTACAGG - Intronic
1016699575 6:147038974-147038996 CTGTGTACCAAACGTGGTCCAGG + Intergenic
1017052308 6:150405103-150405125 CTGTGTTTTTAACGTGTTCCAGG + Intronic
1018334483 6:162771839-162771861 CTGTGCATGAAACATTCTCTCGG + Intronic
1018790831 6:167146399-167146421 TAGAGCAGGAAACGTGTTCCCGG - Intronic
1019622638 7:2000102-2000124 CTGTGCATCCAACGTGTGGCAGG + Intronic
1020138211 7:5598263-5598285 CTTTGCATCAAACCAGTTCCAGG + Intronic
1021000501 7:15324627-15324649 CCTTCCATGAAACATGTTCCTGG - Intronic
1021397595 7:20169368-20169390 CAGTGCAAAAAACGTGTTCTGGG + Intronic
1023894178 7:44418314-44418336 ATGCACATGAGACGTGTTCCAGG + Intronic
1024433979 7:49327273-49327295 CTGTCCATGAAACATGCTGCCGG + Intergenic
1029646908 7:101862690-101862712 CTGATGATGAAACGTGTTCAGGG - Intronic
1032786937 7:135208430-135208452 CTGTGCATGAAACGTGTTCCCGG - Intronic
1034671144 7:152859324-152859346 CTTGGTATGTAACGTGTTCCAGG + Intergenic
1035395211 7:158530473-158530495 CAGTGCATGAAACCTGCTCCAGG - Intronic
1036418514 8:8573364-8573386 CTGTGCAGGAAACATGTTGTTGG - Intergenic
1038622890 8:29161372-29161394 CACTGCATGAAACAAGTTCCAGG + Intronic
1043838659 8:85075217-85075239 CTGTGCATTTATCATGTTCCTGG - Intergenic
1046425255 8:114039341-114039363 CAGTGCATGAAAGATTTTCCAGG + Intergenic
1047673630 8:127175564-127175586 CTGTATATGAAACATTTTCCTGG - Intergenic
1048723798 8:137358742-137358764 GTGTCCATGAAACGGGTCCCTGG + Intergenic
1049990718 9:989187-989209 CTGTGCATGAACTGTTTTGCTGG - Intronic
1052127029 9:24789999-24790021 CTTTTCATAAAACCTGTTCCTGG - Intergenic
1055370325 9:75591531-75591553 CTGAGCATGAAACATTTTCATGG - Intergenic
1057043420 9:91864392-91864414 CTGTCCATGGCTCGTGTTCCTGG - Intronic
1059553055 9:115249917-115249939 CTGCACATGTACCGTGTTCCAGG + Intronic
1061928617 9:133820626-133820648 CTGTGCAAGAAACTTGTTTATGG - Intronic
1187424928 X:19168723-19168745 CTGTGCATGGACAGTGCTCCTGG - Intergenic
1188260644 X:28019081-28019103 CTGTACAGGAAACGTGATGCTGG + Intergenic
1188347355 X:29083434-29083456 CTGGCCATGAAATGTGTTTCAGG - Intronic
1188653636 X:32663848-32663870 ATGTGGAGGAAATGTGTTCCAGG + Intronic
1190118064 X:47638639-47638661 CAGTGCATTAAACATATTCCAGG + Intronic
1193519197 X:82508273-82508295 CTGTACATGAAACATTTACCAGG - Intergenic
1194802080 X:98286274-98286296 CTGTGCAGGAAACATGGTGCTGG - Intergenic
1194864527 X:99049436-99049458 CTGTACAGGAAACATGTTGCTGG + Intergenic
1195472361 X:105245157-105245179 CTTTGCATGATCCGTTTTCCAGG + Intronic
1198417603 X:136436191-136436213 CTGTGTATCTAACGTGCTCCTGG + Intergenic
1201928016 Y:19311225-19311247 CCCTGCATCAAACGTCTTCCTGG + Intergenic