ID: 1032790438

View in Genome Browser
Species Human (GRCh38)
Location 7:135238498-135238520
Sequence CTCTGGGCTTGTAGGGAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 137}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032790438_1032790449 26 Left 1032790438 7:135238498-135238520 CCAGATTCCCTACAAGCCCAGAG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1032790449 7:135238547-135238569 GTTAGAGAACTTGAGGTCCTGGG No data
1032790438_1032790450 29 Left 1032790438 7:135238498-135238520 CCAGATTCCCTACAAGCCCAGAG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1032790450 7:135238550-135238572 AGAGAACTTGAGGTCCTGGGAGG 0: 1
1: 0
2: 1
3: 18
4: 285
1032790438_1032790447 19 Left 1032790438 7:135238498-135238520 CCAGATTCCCTACAAGCCCAGAG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1032790447 7:135238540-135238562 TGAGACTGTTAGAGAACTTGAGG 0: 1
1: 0
2: 1
3: 15
4: 252
1032790438_1032790448 25 Left 1032790438 7:135238498-135238520 CCAGATTCCCTACAAGCCCAGAG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1032790448 7:135238546-135238568 TGTTAGAGAACTTGAGGTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032790438 Original CRISPR CTCTGGGCTTGTAGGGAATC TGG (reversed) Intronic
901083066 1:6594328-6594350 CTCTGGGCTTGTTGAGAAGAGGG - Intronic
901457119 1:9369414-9369436 CTCTGGGCTGGTAGGAAAGAAGG - Exonic
902247230 1:15128977-15128999 CTCCTGGCTGGAAGGGAATCTGG - Intergenic
908433839 1:64085483-64085505 CTCTGGCCATGTTGGGAATATGG - Intronic
913209762 1:116572382-116572404 CCCTGGGCTGGTAGGAACTCAGG + Intergenic
916107627 1:161442616-161442638 CCCTGGGCTGGTAGGGAGGCTGG - Intergenic
916109211 1:161450034-161450056 CCCTGGGCTGGTAGGGAGGCTGG - Intergenic
916110797 1:161457415-161457437 CCCTGGGCTGGTAGGGAGGCTGG - Intergenic
916112384 1:161464825-161464847 CCCTGGGCTGGTAGGGAGGCTGG - Intergenic
916113970 1:161472206-161472228 CCCTGGGCTGGTAGGGAGGCTGG - Intergenic
919452490 1:197788077-197788099 CTCTGGGCTGGTCTGGAACCTGG + Intergenic
920423862 1:205857742-205857764 CTTGTGGCTTGTATGGAATCCGG + Intergenic
920741168 1:208582587-208582609 CTCTGGCCTTGTAGGAAATATGG + Intergenic
923961134 1:239084986-239085008 CTCTGGGGTTGTGTGGAAGCTGG - Intergenic
924554602 1:245107815-245107837 AACTGTGCTTGGAGGGAATCTGG - Intronic
1064665232 10:17644111-17644133 CGCGGAGCTTGTCGGGAATCTGG - Exonic
1069316262 10:67107226-67107248 CTCTGAGCTTTTAGGCAATCAGG - Intronic
1069872392 10:71541025-71541047 CGCTGGGCTTGCAGGAGATCTGG - Intronic
1070268943 10:74933102-74933124 CTAGGGGGTTGTGGGGAATCTGG - Intronic
1070508596 10:77139286-77139308 ATCTGGCCTTGGAGAGAATCAGG - Intronic
1071795152 10:88996910-88996932 CTCTGGGCTTGTAAGGGCTCTGG + Intronic
1074439079 10:113459169-113459191 CCCTGTGTTTGAAGGGAATCCGG - Intergenic
1074863864 10:117533807-117533829 CTCAGGGCTTGCAGTGAACCTGG - Intergenic
1075609125 10:123837032-123837054 CTCTTTGCTTCTTGGGAATCTGG - Intronic
1076637535 10:131892041-131892063 GGCTGGGCTTGGAGGGAAGCTGG + Intergenic
1077909132 11:6558851-6558873 CTGTGAGCTTGTAGGAAAACAGG - Intronic
1078097828 11:8311419-8311441 TTCTGCGCTTGAAGAGAATCCGG + Intergenic
1079004941 11:16784887-16784909 CCCTGGGCTGGCAGGCAATCAGG + Intronic
1080041522 11:27764205-27764227 CTCTGGACATGGAGGGAATAAGG - Intergenic
1081204215 11:40256159-40256181 CTCTGGGCATCTAGAGAATGAGG + Intronic
1082813573 11:57493716-57493738 CTCTGGGCCTGTCGGGTAGCTGG - Intronic
1085717886 11:78889325-78889347 CCCTGGGCTTGGAGGGAAACTGG - Intronic
1087381418 11:97409145-97409167 CTCTGGGCTGGTCTGGAACCAGG - Intergenic
1088009887 11:104986865-104986887 TTCTGGGCCTGTAGAGAACCTGG + Intergenic
1088461665 11:110089999-110090021 CTGTGTACTAGTAGGGAATCTGG - Intergenic
1089359991 11:117879347-117879369 CTTTGGGCTTGTAAAGAAGCAGG - Intergenic
1090974727 11:131671452-131671474 CTCTGGGCTTGCAGAGAATGTGG + Intronic
1091002023 11:131917771-131917793 CTCTGGGCTTGCCAGGCATCCGG + Intronic
1091309629 11:134563214-134563236 CTCTGGGCTCTTGGGGAAGCTGG + Intergenic
1091719306 12:2801059-2801081 CTCAGGGCTTGTAGCTCATCTGG - Intronic
1092658089 12:10708939-10708961 CTCTGGGCTTCTAGGAAACAAGG - Intronic
1092874387 12:12835453-12835475 CTCTGGGCAGGTAAGAAATCAGG + Intergenic
1097009262 12:55940765-55940787 CTCTGTGCGTGTGGGAAATCGGG - Intronic
1098949762 12:76627781-76627803 CTCTGGGTTTTTAGAAAATCTGG - Intergenic
1100773890 12:97953671-97953693 CTCTACCCTTGTAGGGAGTCAGG - Intergenic
1102214525 12:111150918-111150940 CTTTGGAATTGTTGGGAATCAGG - Intronic
1102259712 12:111436594-111436616 CTCTGGGCTGGTCTGGAAGCAGG + Intronic
1104873306 12:132015969-132015991 GTCTGGGCAGGTAGGGAGTCTGG - Intronic
1107045805 13:35990971-35990993 CTCTTGCCTTGTAAGGAACCTGG - Intronic
1107104559 13:36629390-36629412 CATTGGACTTGAAGGGAATCAGG - Intergenic
1109325242 13:60859427-60859449 CTCTAGGCTGGTAGGGTATGTGG + Intergenic
1113382006 13:109812952-109812974 CTCTGAGGCTGTAGGGAATCAGG - Intergenic
1116555760 14:46304680-46304702 CACTGGGCTTCTAGGGAGTCCGG + Intergenic
1116788016 14:49309346-49309368 CTGTGGCCTTGTGGGAAATCTGG - Intergenic
1121407170 14:93726109-93726131 CCCTGGGCTTGGAGGGCAGCAGG + Intronic
1122779959 14:104139349-104139371 CTTGGGGCTTGGAGGGAAGCAGG + Intronic
1125885917 15:43229401-43229423 CTCTGGGGTTGGAGGAAAGCTGG + Intergenic
1127183477 15:56451324-56451346 CTCTGAGCTAGGAGGGAATGAGG + Intronic
1130051583 15:80487925-80487947 CACAGGGCTTACAGGGAATCAGG + Intronic
1133405572 16:5521653-5521675 CTCTAGGTTTGTAAGCAATCAGG + Intergenic
1137640651 16:50025525-50025547 CTCTAGGTTTGTGGGGACTCAGG - Intronic
1138271862 16:55701460-55701482 CTCTGGCCCTGCAGGGAATCAGG - Intronic
1138416428 16:56874152-56874174 CTCTGAGCTGGGAGGGAATAGGG - Intronic
1140123094 16:72099987-72100009 ATCTGGGCTTCTCGGCAATCAGG - Intronic
1140224773 16:73068375-73068397 CTCTGGTTTTGTATGGATTCAGG + Intergenic
1141908868 16:87045044-87045066 CTCTGGGCTTGTGGGGCCTCGGG - Intergenic
1143504625 17:7356815-7356837 CACTGGGATTGTGGGGGATCTGG - Exonic
1146182539 17:30707391-30707413 CCCTGGACATGTAGGGAATGGGG + Intergenic
1147420981 17:40322085-40322107 CTCTGGGCCAGTGGGGAGTCTGG + Intronic
1151560755 17:74868236-74868258 CTCTGGGCTTGGAGTCAAACAGG + Intronic
1154174568 18:12076824-12076846 CTCTGGGCCTGGAGGGAGCCAGG + Intergenic
1158989743 18:62856289-62856311 CTCAGGCCTTGTAAGGACTCTGG - Intronic
1159890480 18:73948594-73948616 GTCTGGGCTTGTTGGGAAATGGG + Intergenic
1162199573 19:9010659-9010681 CTCTGGGCTTGAAGGAAAACAGG + Intergenic
1162366019 19:10250246-10250268 CCCTGGACTGGTAGGGAAGCCGG + Intergenic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1166464366 19:43019147-43019169 CCATGGGCTTTTAGGGACTCGGG - Intronic
1167347503 19:48955492-48955514 CTCTTGGGTTCTAGGGGATCAGG - Intronic
1167414413 19:49362561-49362583 CTCGGGGCTGGTAGGAACTCAGG + Intronic
1167724073 19:51199280-51199302 CTCTGTGCACGTGGGGAATCAGG + Intergenic
926633113 2:15155564-15155586 CTCAAGGCTTCCAGGGAATCAGG + Intergenic
927631165 2:24775345-24775367 CTATGAGCTTGTAAGGAATTTGG - Intergenic
927884999 2:26712925-26712947 CTCTGGGCTGGCAGGGAATTTGG - Intronic
929238785 2:39632206-39632228 CCCTGGCCTTGAAGGGATTCAGG + Intergenic
932111767 2:69008382-69008404 CTCTGGGCTTGTCAGGACCCTGG + Intergenic
936894483 2:117411915-117411937 CTCTGGGTTTGTAGAGTTTCTGG - Intergenic
940533306 2:154906939-154906961 CTCTGGTCTTGTTAGAAATCTGG - Intergenic
943032110 2:182697744-182697766 GTCTAGGCTTGGAGGGAATTAGG + Intergenic
945846142 2:214947505-214947527 CTCTGTCCTTGAAGGGCATCAGG + Exonic
948175411 2:235939073-235939095 CTCTGGGTTTATACAGAATCAGG - Intronic
1170843508 20:19943075-19943097 CCCCGGGCTTGAAGGGCATCGGG + Intronic
1171399515 20:24863333-24863355 CTCTGCGGTTGTTGGGATTCAGG - Intergenic
1173014729 20:39214877-39214899 CTCAGGGATTGGAAGGAATCAGG + Intergenic
1173177503 20:40775480-40775502 CTCTGGTCTGGCAGGGCATCAGG + Intergenic
1173457783 20:43217201-43217223 CTTTGGGTTTCTAAGGAATCTGG + Intergenic
1173494073 20:43506576-43506598 ATCTGGCCTGGGAGGGAATCAGG + Intergenic
1174519425 20:51118325-51118347 CTCAGGCCTTGCAGTGAATCTGG + Intergenic
1176075494 20:63246460-63246482 CTCTGGTCCTGCAGGAAATCAGG - Intronic
1177473215 21:21584888-21584910 CTCTTGGCTTGTGGGGATTATGG - Intergenic
1183731666 22:39621891-39621913 CTCTGGGATTGGAGGGGATGAGG - Intronic
1184354907 22:43973347-43973369 CTCTGGGCTTGGGGGAAAACAGG + Intronic
949733783 3:7146533-7146555 GCCTGGGCTTGGAAGGAATCGGG - Exonic
950635739 3:14313202-14313224 CTCTGTGCTAGTCGGGATTCTGG + Intergenic
954056111 3:48027359-48027381 CTCTGGGCTTGGTGGGAGTTGGG - Intronic
965954021 3:174346282-174346304 CTCAGGGCTTTAAGGGAATAGGG - Intergenic
969347807 4:6580275-6580297 CTCTGGGCCTGTGGGGATGCAGG - Intronic
977704118 4:100052300-100052322 CTCTGGGCCTGTGAGGAAACGGG + Intergenic
986436487 5:7737290-7737312 CTCTAGACTTGTAAGGAAACAGG + Intronic
989337376 5:40334350-40334372 GTCTGGGCTTACAGGGGATCAGG + Intergenic
991991479 5:72344144-72344166 CTGTGGGGTTGGAGGGAATGAGG + Intronic
992135636 5:73741186-73741208 TTCTGGTCTTGTGAGGAATCTGG + Intronic
995547057 5:113243441-113243463 CTCTGTTCTTTTAGGGAATGTGG - Intronic
997519256 5:134512186-134512208 CTCTAGGCCTGCAGGGAAGCTGG - Intergenic
1000280491 5:159777572-159777594 CAGTGGGCTTCAAGGGAATCGGG + Intergenic
1001541591 5:172543312-172543334 CTCTGGGTTTGTGGGGACCCTGG - Intergenic
1007085429 6:39141046-39141068 CTCAGGGCTCCTAGGGAATAAGG + Intergenic
1012815255 6:104016074-104016096 CTCTGTGCATGAAGGGAATATGG - Intergenic
1017232771 6:152090896-152090918 ATCTGAGCTTCTAGGCAATCTGG - Intronic
1018681463 6:166269338-166269360 TTCTGGGCTTTTAGGAAATGTGG + Intergenic
1019107846 6:169683813-169683835 CTCAGGGCTTGCAGGGACTGTGG - Intronic
1022774481 7:33511433-33511455 CTCTGGGATTCTATGCAATCAGG - Intronic
1023514056 7:40982957-40982979 CTCTGGGCTTCTTGGTCATCAGG - Intergenic
1024410907 7:49039740-49039762 CTCTGGGTTGGTAGGGAGTCAGG - Intergenic
1025606672 7:63044525-63044547 CTCTGGGGTAGTAGGGATGCAGG - Intergenic
1025799666 7:64774044-64774066 CTCTGGGGTTGCAGAGAATATGG + Intergenic
1028655528 7:93201860-93201882 CTCTAGGATGGTAGAGAATCTGG - Intronic
1032790438 7:135238498-135238520 CTCTGGGCTTGTAGGGAATCTGG - Intronic
1034426146 7:151015278-151015300 CTTGGGGCTTGTAGGGGATGGGG - Intronic
1035743919 8:1947902-1947924 CTCTATGCTTGGAGGGAAGCAGG - Intronic
1035873860 8:3165823-3165845 CTCTGAGCTTTTTGGGAATGCGG + Intronic
1037224411 8:16567718-16567740 CACTGGGCTTGTGTGGAATGTGG - Intergenic
1039412052 8:37363133-37363155 CTCTGGCCTTGGGGAGAATCTGG - Intergenic
1042927824 8:73984464-73984486 CTCTGGGGTTGCAGGGATGCGGG - Intergenic
1045186812 8:99846460-99846482 CTTTGGACTTGTGGGGAACCTGG + Intronic
1047174102 8:122524197-122524219 CTCTTGGCTGGTAAGGAATAGGG - Intergenic
1047825137 8:128565144-128565166 CCCTGGGGTTGGAGAGAATCTGG + Intergenic
1049606964 8:143534237-143534259 CTCTGGCCTGGGAGGGAAGCAGG + Intronic
1050535587 9:6627933-6627955 CTCTGGGCTTCTAGGTACACTGG - Intronic
1056365273 9:85898679-85898701 CTTTGGGCTTGTAGGGCTTCTGG - Intergenic
1058538979 9:105992495-105992517 CTCTGGCTTGGTAGGGAATGGGG - Intergenic
1061001438 9:127905057-127905079 CTCTGGGCTTGGAGGAAGTAGGG + Intronic
1062544560 9:137055660-137055682 CGCTGGGCCTGGAGGGAAGCGGG - Intergenic
1189180030 X:38995077-38995099 CTCAAGGCTTATAGGGAAGCTGG + Intergenic
1195310078 X:103624270-103624292 CTCTGAGCTTGTCTGGATTCTGG + Intronic
1195311674 X:103638268-103638290 CTCTGAGCTTGTCTGGATTCTGG + Intergenic
1199766215 X:150943359-150943381 CTCTGGTCTTGTATGCAACCTGG + Intergenic
1201342192 Y:12946716-12946738 CTCTGGGCTGATCTGGAATCTGG + Intergenic