ID: 1032790568

View in Genome Browser
Species Human (GRCh38)
Location 7:135239499-135239521
Sequence CCCCATTAGGTGCTCAGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032790568_1032790574 3 Left 1032790568 7:135239499-135239521 CCAGTACTGAGCACCTAATGGGG 0: 1
1: 0
2: 1
3: 6
4: 121
Right 1032790574 7:135239525-135239547 AGGCTCTGTGTTACGCACTGAGG No data
1032790568_1032790575 4 Left 1032790568 7:135239499-135239521 CCAGTACTGAGCACCTAATGGGG 0: 1
1: 0
2: 1
3: 6
4: 121
Right 1032790575 7:135239526-135239548 GGCTCTGTGTTACGCACTGAGGG 0: 1
1: 0
2: 4
3: 23
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032790568 Original CRISPR CCCCATTAGGTGCTCAGTAC TGG (reversed) Intronic
902713901 1:18259369-18259391 GGACAGTAGGTGCTCAGTACAGG + Intronic
902815193 1:18912628-18912650 ACCCATTAGGTGCTGGGCACTGG + Intronic
902869235 1:19303534-19303556 ACCCATTAGGTTCTCAGTCTTGG - Intergenic
903277656 1:22232078-22232100 ACCCACTAGGTGCTCAATAATGG - Intergenic
903374206 1:22855505-22855527 CCCCAGTAGGTGCCAGGTACTGG - Intronic
904484429 1:30815376-30815398 CCCCAGTAGGTGCTCTGTAAGGG + Intergenic
906825084 1:48970920-48970942 ACATAGTAGGTGCTCAGTACAGG - Intronic
911647716 1:100353262-100353284 CCCCATGAGCTGCTGAGTGCCGG - Intronic
912967421 1:114248658-114248680 CCCCTTGAGGGGCTCAGTTCTGG - Intergenic
913685706 1:121230044-121230066 CCTCATTATGTGCCAAGTACTGG + Intronic
914037553 1:144017647-144017669 CCTCATTATGTGCCAAGTACTGG + Intergenic
914151901 1:145050285-145050307 CCTCATTATGTGCCAAGTACTGG - Intronic
920057096 1:203200805-203200827 CCCTATTAGGTGCCAAGTCCTGG + Intergenic
920473026 1:206248601-206248623 CCTCATTATGTGCCAAGTACTGG + Intronic
922982007 1:229835074-229835096 CCTCATTAGCTGCTCTGAACAGG - Intergenic
923000358 1:230002056-230002078 TCCCATTAAGTGCTCAGGCCTGG + Intergenic
1065761802 10:28989636-28989658 ACACATTAGGTGCTCAATAAAGG + Intergenic
1066957661 10:42188367-42188389 CCCCATGAGGTCATCAGTGCTGG - Intergenic
1069145795 10:64890749-64890771 CCCCATGAGGTGATTAGTGCAGG - Intergenic
1070559529 10:77555356-77555378 CCCCATGAGGTCTTCAGTCCTGG - Intronic
1073585898 10:104709526-104709548 GCAGAGTAGGTGCTCAGTACAGG - Intronic
1074500369 10:114018093-114018115 CCCCATGAGCTCCTCAGGACAGG + Intergenic
1078280188 11:9893533-9893555 CACCATTAGGTGCTTACCACAGG - Intronic
1080978932 11:37377165-37377187 CCCCAGTAGGGACTCTGTACCGG + Intergenic
1084266270 11:68006963-68006985 ACACAGTAGGTGCTCAGTAAAGG + Intergenic
1089903650 11:122013900-122013922 CCCCATGAGGCCATCAGTACAGG - Intergenic
1093536622 12:20230771-20230793 CCCCAGTAGGGACTCTGTACTGG + Intergenic
1096496096 12:52040316-52040338 CCCCATCTGGTTCTCAGAACGGG - Intronic
1104769980 12:131355503-131355525 CCCCATGATGTGCTCTGTCCAGG - Intergenic
1108044061 13:46366251-46366273 GCCCATCAGGTGCTCTGTCCTGG + Intronic
1111895671 13:94138811-94138833 ACCTGTTAGGTACTCAGTACAGG - Intronic
1114217392 14:20667151-20667173 CCCCACTAGGTGTTCAGCAGGGG - Intergenic
1116229982 14:42203586-42203608 ACACATTAGCTGCTCACTACAGG - Intergenic
1202935441 14_KI270725v1_random:83409-83431 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1123498489 15:20855846-20855868 CCACATTAGGTTCTGAATACAGG + Intronic
1123555724 15:21429474-21429496 CCACATTAGGTTCTGAATACAGG + Intronic
1123591966 15:21866805-21866827 CCACATTAGGTTCTGAATACAGG + Intergenic
1127620182 15:60726416-60726438 ACACAGTAGGTGCTCAATACTGG - Intronic
1129721017 15:77878048-77878070 CCTCATTAGGGGCTAATTACTGG - Intergenic
1130393304 15:83478810-83478832 GCACATGAGGTGCTCAGCACAGG + Intronic
1132278261 15:100589454-100589476 CCACATTAGGTGCATAGCACTGG - Intronic
1202964065 15_KI270727v1_random:156684-156706 CCACATTAGGTTCTGAATACAGG + Intergenic
1134491753 16:14701024-14701046 CCACACTAGGTGCTCAGTGAAGG + Intergenic
1134497134 16:14740142-14740164 CCACACTAGGTGCTCAGTGAAGG + Intronic
1135061501 16:19275015-19275037 CCATATTGGGTGCTCAGTGCTGG + Intergenic
1139356405 16:66369373-66369395 ACACAGTAGGTGCTCAGTAAGGG - Intronic
1142636116 17:1258927-1258949 CCCCATGAAGCGCTCAGTTCAGG - Intergenic
1152270461 17:79321638-79321660 CCCCATAAGGTGCACAGTACAGG + Intronic
1153131895 18:1863350-1863372 CCACATTAAGTCCTCAGGACAGG + Intergenic
1153188058 18:2506989-2507011 TCCCACTAAGTGCTCGGTACTGG - Intergenic
1153949992 18:10050261-10050283 CCCCATTCAGTGCTGAGCACAGG + Intergenic
1154456494 18:14532271-14532293 CCACATTAGGTTCTGAATACAGG + Intronic
1157572780 18:48723994-48724016 CCCCCGTGGGTGCTAAGTACAGG - Intronic
1159856587 18:73596581-73596603 TCCCTTGAGGAGCTCAGTACTGG - Intergenic
1162894146 19:13754901-13754923 ACACAGTAGGTGCTCAGTAAGGG + Intronic
1164097049 19:22021067-22021089 CCCCCTTAGGTCATCAGTGCAGG + Intergenic
1164117221 19:22234289-22234311 CCCCATTAGGTCATCAGTGCAGG + Intergenic
927788597 2:25992004-25992026 ACCCATTAGGTTCTCAGTAAAGG - Intergenic
930227804 2:48812207-48812229 CCCCAGTAGGGACTCAGTATGGG + Intergenic
934225054 2:90125090-90125112 CCCCAGTAGGGGCTCAGTGTGGG + Intergenic
934305781 2:91820881-91820903 CCCCATGAGGTCATCAGTGCAGG - Intergenic
934327475 2:92031861-92031883 CCCCATGAGGTCATCAGTGCAGG + Intergenic
934465862 2:94262441-94262463 CCCCATGAGGTCATCAGTGCAGG + Intergenic
935706425 2:105861408-105861430 CCACATTAGGTGCTGTGTGCTGG + Intronic
938622393 2:133069669-133069691 CCCCATTAGATGCTCTGTTTGGG + Intronic
944584421 2:201160949-201160971 CCCCAGGAGGTGGTCAGTTCCGG + Intronic
945859129 2:215100550-215100572 TCCCATTATGTGCAAAGTACTGG + Intronic
946753261 2:222915205-222915227 CCCCATGAAATGCTCAGCACAGG - Intronic
1172434641 20:34920476-34920498 CTCCATTTGGTGGTCAGTAGGGG + Intronic
1172567935 20:35945605-35945627 GTCCAGAAGGTGCTCAGTACAGG + Intronic
1173812028 20:45961938-45961960 CCCCATTTGCTGCACACTACAGG - Intronic
1176031890 20:63016864-63016886 CCCCATAAGGTGCTCAGCAGGGG - Intergenic
1176159934 20:63642745-63642767 CCCAATTAGGTGCCCAGGAGCGG + Intronic
1176596862 21:8705645-8705667 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1176817670 21:13621066-13621088 CCACATTAGGTTCTGAATACAGG - Intronic
1178988105 21:37326071-37326093 ACCTATTGGGTGCTCACTACCGG + Intergenic
1179245345 21:39628700-39628722 TCCCATTAGGTCCCCTGTACAGG - Intronic
1180279782 22:10683087-10683109 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1180587000 22:16901613-16901635 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1181573920 22:23782217-23782239 CTCCGGCAGGTGCTCAGTACTGG + Exonic
949401661 3:3671079-3671101 CCCCACGAAGTGCTCGGTACTGG - Intergenic
961503501 3:127354873-127354895 CCCCCTGAGGTGCTCAGAGCCGG - Intergenic
968913775 4:3488314-3488336 CCCCATCAGGACCTCAGAACAGG - Intronic
971488864 4:27190364-27190386 CCTCATTTGGTTCTCATTACTGG - Intergenic
974289608 4:59913027-59913049 CCCCATGAGGTCATCAGTGCAGG - Intergenic
974741484 4:66013530-66013552 CCCCATTAGGGGCCCAGAACTGG - Intergenic
976091151 4:81459346-81459368 CCACATTAGGTACTAAGTGCTGG + Exonic
976785598 4:88816655-88816677 CCCCATTAGAAGCTTAGTAAAGG - Intronic
978249262 4:106610598-106610620 CCCACTTAGGTCCTCAGGACTGG - Intergenic
978556801 4:109989807-109989829 CCCCATTGCGTGCTCGATACTGG - Intronic
982424954 4:155247447-155247469 CCCCAGTAGGGACTCAGTATGGG + Intergenic
990038988 5:51356679-51356701 CCATATTAGATGCTTAGTACTGG - Intergenic
990698722 5:58452180-58452202 CCAGATCTGGTGCTCAGTACTGG + Intergenic
992212976 5:74498441-74498463 GCCCACTATGTGCTCAGTTCTGG - Intergenic
992739846 5:79762702-79762724 CCTCAGTAGGTGCTCAATAAAGG - Intronic
993430931 5:87831411-87831433 CCCCATTAGGGACTCAGTTTGGG + Intergenic
1004835232 6:19523408-19523430 AGCCATTACCTGCTCAGTACAGG - Intergenic
1007829540 6:44627834-44627856 GCCCAGTAGGTGCTCAGGCCAGG + Intergenic
1008625726 6:53314544-53314566 ACACATTTGGTGCTCAGTAAAGG - Intronic
1010651005 6:78455467-78455489 CCCCATTGGGAACTCAGTATGGG + Intergenic
1012246815 6:96935569-96935591 CCTCATTAGGTGGTTAGTATTGG + Intronic
1020520813 7:9184469-9184491 CCTCATTCGGTTCTCAGAACAGG + Intergenic
1021161778 7:17282473-17282495 ACACATTATGTGCTCAGTAAAGG - Intergenic
1022126557 7:27363236-27363258 TCCCATTATGTGCTCAGCACAGG - Intergenic
1025604688 7:63030938-63030960 ACACAGTAGGTGCTCAGTAAAGG - Intergenic
1032790568 7:135239499-135239521 CCCCATTAGGTGCTCAGTACTGG - Intronic
1036702903 8:11024930-11024952 CACCATTAGGTGGTCAAGACCGG + Intronic
1037400934 8:18494629-18494651 CCCCATGAAGTGCTGAGTCCTGG + Intergenic
1038044254 8:23752893-23752915 CCCCACCAGGTGATCAGAACAGG - Intergenic
1039453355 8:37693169-37693191 CCCCATTTAGTGCTCTGTATAGG + Intergenic
1044473298 8:92597376-92597398 GCCCATTGGGAGTTCAGTACTGG - Intergenic
1045617863 8:103939120-103939142 CCCCAGTAGGGACTCTGTACCGG + Intronic
1047013027 8:120692860-120692882 CCATGTAAGGTGCTCAGTACAGG - Intronic
1047366083 8:124212841-124212863 TCCCATCAGGTGCACAGGACGGG + Intergenic
1049236006 8:141512712-141512734 CCCCAGGAGGTGCTCAGTGGCGG + Intergenic
1051450656 9:17193755-17193777 CCCTAGTAGGTGCTCTGTATGGG + Intronic
1052442227 9:28511996-28512018 CCCCATGAGGTCATCAGTGCAGG + Intronic
1053695919 9:40639217-40639239 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1054307166 9:63438435-63438457 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1054439525 9:65247914-65247936 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1054490882 9:65774025-65774047 CCCCATGAGGTCATCAGTGCAGG - Intergenic
1059332765 9:113546454-113546476 CCGTAGTAGGTGCTCAGTAGAGG + Intronic
1202778366 9_KI270717v1_random:12830-12852 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1203529690 Un_GL000213v1:128435-128457 CCACATTAGGTTCTGAATACAGG + Intergenic
1186384057 X:9091476-9091498 CCCCATGAGGCCATCAGTACAGG + Intronic
1195285511 X:103378789-103378811 CCCCATCAGGTACTTAGGACTGG + Intergenic
1195554887 X:106210600-106210622 CCCCATGAGGTGTGCAGTGCTGG - Intergenic
1197335984 X:125210067-125210089 GCCTATTCGGTGCTAAGTACTGG + Intergenic
1201193679 Y:11471134-11471156 CCCCATGAGGTCATCAGTGCAGG + Intergenic