ID: 1032795378

View in Genome Browser
Species Human (GRCh38)
Location 7:135271953-135271975
Sequence TGCTGTTTACAAAACCCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032795378_1032795383 -4 Left 1032795378 7:135271953-135271975 CCCCCCGGGTTTTGTAAACAGCA No data
Right 1032795383 7:135271972-135271994 AGCATTATGAGTTCACAGACAGG No data
1032795378_1032795384 -3 Left 1032795378 7:135271953-135271975 CCCCCCGGGTTTTGTAAACAGCA No data
Right 1032795384 7:135271973-135271995 GCATTATGAGTTCACAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032795378 Original CRISPR TGCTGTTTACAAAACCCGGG GGG (reversed) Intergenic