ID: 1032795383

View in Genome Browser
Species Human (GRCh38)
Location 7:135271972-135271994
Sequence AGCATTATGAGTTCACAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032795381_1032795383 -7 Left 1032795381 7:135271956-135271978 CCCGGGTTTTGTAAACAGCATTA No data
Right 1032795383 7:135271972-135271994 AGCATTATGAGTTCACAGACAGG No data
1032795376_1032795383 1 Left 1032795376 7:135271948-135271970 CCCAGCCCCCCGGGTTTTGTAAA No data
Right 1032795383 7:135271972-135271994 AGCATTATGAGTTCACAGACAGG No data
1032795382_1032795383 -8 Left 1032795382 7:135271957-135271979 CCGGGTTTTGTAAACAGCATTAT No data
Right 1032795383 7:135271972-135271994 AGCATTATGAGTTCACAGACAGG No data
1032795379_1032795383 -5 Left 1032795379 7:135271954-135271976 CCCCCGGGTTTTGTAAACAGCAT No data
Right 1032795383 7:135271972-135271994 AGCATTATGAGTTCACAGACAGG No data
1032795375_1032795383 9 Left 1032795375 7:135271940-135271962 CCACTGCACCCAGCCCCCCGGGT No data
Right 1032795383 7:135271972-135271994 AGCATTATGAGTTCACAGACAGG No data
1032795380_1032795383 -6 Left 1032795380 7:135271955-135271977 CCCCGGGTTTTGTAAACAGCATT No data
Right 1032795383 7:135271972-135271994 AGCATTATGAGTTCACAGACAGG No data
1032795378_1032795383 -4 Left 1032795378 7:135271953-135271975 CCCCCCGGGTTTTGTAAACAGCA No data
Right 1032795383 7:135271972-135271994 AGCATTATGAGTTCACAGACAGG No data
1032795377_1032795383 0 Left 1032795377 7:135271949-135271971 CCAGCCCCCCGGGTTTTGTAAAC No data
Right 1032795383 7:135271972-135271994 AGCATTATGAGTTCACAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032795383 Original CRISPR AGCATTATGAGTTCACAGAC AGG Intergenic