ID: 1032800871

View in Genome Browser
Species Human (GRCh38)
Location 7:135316452-135316474
Sequence CACGTTGCTCTGCTGGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032800871_1032800877 7 Left 1032800871 7:135316452-135316474 CCCAGTTCCAGCAGAGCAACGTG No data
Right 1032800877 7:135316482-135316504 AAACCAGCAGCATCTCAGAATGG No data
1032800871_1032800879 23 Left 1032800871 7:135316452-135316474 CCCAGTTCCAGCAGAGCAACGTG No data
Right 1032800879 7:135316498-135316520 AGAATGGTGACTTCGTCATCTGG No data
1032800871_1032800880 24 Left 1032800871 7:135316452-135316474 CCCAGTTCCAGCAGAGCAACGTG No data
Right 1032800880 7:135316499-135316521 GAATGGTGACTTCGTCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032800871 Original CRISPR CACGTTGCTCTGCTGGAACT GGG (reversed) Intergenic
No off target data available for this crispr