ID: 1032801812

View in Genome Browser
Species Human (GRCh38)
Location 7:135322841-135322863
Sequence GGGTGTGTTAATTCAAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032801812_1032801817 25 Left 1032801812 7:135322841-135322863 CCTGCATTTGAATTAACACACCC No data
Right 1032801817 7:135322889-135322911 TATAAAGTTTGAATGGCTTCTGG No data
1032801812_1032801816 18 Left 1032801812 7:135322841-135322863 CCTGCATTTGAATTAACACACCC No data
Right 1032801816 7:135322882-135322904 TTATGGATATAAAGTTTGAATGG No data
1032801812_1032801819 27 Left 1032801812 7:135322841-135322863 CCTGCATTTGAATTAACACACCC No data
Right 1032801819 7:135322891-135322913 TAAAGTTTGAATGGCTTCTGGGG No data
1032801812_1032801815 1 Left 1032801812 7:135322841-135322863 CCTGCATTTGAATTAACACACCC No data
Right 1032801815 7:135322865-135322887 AATTGACTCTTTGTTTTTTATGG No data
1032801812_1032801818 26 Left 1032801812 7:135322841-135322863 CCTGCATTTGAATTAACACACCC No data
Right 1032801818 7:135322890-135322912 ATAAAGTTTGAATGGCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032801812 Original CRISPR GGGTGTGTTAATTCAAATGC AGG (reversed) Intergenic
No off target data available for this crispr