ID: 1032801815

View in Genome Browser
Species Human (GRCh38)
Location 7:135322865-135322887
Sequence AATTGACTCTTTGTTTTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032801811_1032801815 4 Left 1032801811 7:135322838-135322860 CCTCCTGCATTTGAATTAACACA No data
Right 1032801815 7:135322865-135322887 AATTGACTCTTTGTTTTTTATGG No data
1032801812_1032801815 1 Left 1032801812 7:135322841-135322863 CCTGCATTTGAATTAACACACCC No data
Right 1032801815 7:135322865-135322887 AATTGACTCTTTGTTTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032801815 Original CRISPR AATTGACTCTTTGTTTTTTA TGG Intergenic
No off target data available for this crispr