ID: 1032801817

View in Genome Browser
Species Human (GRCh38)
Location 7:135322889-135322911
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032801814_1032801817 4 Left 1032801814 7:135322862-135322884 CCAAATTGACTCTTTGTTTTTTA No data
Right 1032801817 7:135322889-135322911 TATAAAGTTTGAATGGCTTCTGG No data
1032801811_1032801817 28 Left 1032801811 7:135322838-135322860 CCTCCTGCATTTGAATTAACACA No data
Right 1032801817 7:135322889-135322911 TATAAAGTTTGAATGGCTTCTGG No data
1032801813_1032801817 5 Left 1032801813 7:135322861-135322883 CCCAAATTGACTCTTTGTTTTTT No data
Right 1032801817 7:135322889-135322911 TATAAAGTTTGAATGGCTTCTGG No data
1032801812_1032801817 25 Left 1032801812 7:135322841-135322863 CCTGCATTTGAATTAACACACCC No data
Right 1032801817 7:135322889-135322911 TATAAAGTTTGAATGGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032801817 Original CRISPR TATAAAGTTTGAATGGCTTC TGG Intergenic
No off target data available for this crispr