ID: 1032801942

View in Genome Browser
Species Human (GRCh38)
Location 7:135323965-135323987
Sequence CTGCTGTTCCTCAGGAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032801940_1032801942 -10 Left 1032801940 7:135323952-135323974 CCTGCAAGCATCACTGCTGTTCC No data
Right 1032801942 7:135323965-135323987 CTGCTGTTCCTCAGGAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032801942 Original CRISPR CTGCTGTTCCTCAGGAAAGA AGG Intergenic
No off target data available for this crispr