ID: 1032805754

View in Genome Browser
Species Human (GRCh38)
Location 7:135352664-135352686
Sequence CAGAATAATTCGATGTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032805754_1032805757 8 Left 1032805754 7:135352664-135352686 CCAGGCCACATCGAATTATTCTG No data
Right 1032805757 7:135352695-135352717 TATACATGCTAACCTCAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032805754 Original CRISPR CAGAATAATTCGATGTGGCC TGG (reversed) Intergenic
No off target data available for this crispr