ID: 1032819313

View in Genome Browser
Species Human (GRCh38)
Location 7:135510057-135510079
Sequence GATGGTGGCCCGTCTGGCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032819313_1032819320 17 Left 1032819313 7:135510057-135510079 CCACAGCCAGACGGGCCACCATC 0: 1
1: 0
2: 0
3: 7
4: 153
Right 1032819320 7:135510097-135510119 TCCTCCGGCCTCCCGTGCGCAGG 0: 1
1: 0
2: 1
3: 8
4: 116
1032819313_1032819319 2 Left 1032819313 7:135510057-135510079 CCACAGCCAGACGGGCCACCATC 0: 1
1: 0
2: 0
3: 7
4: 153
Right 1032819319 7:135510082-135510104 ACATTAGGGTAAGACTCCTCCGG 0: 1
1: 0
2: 0
3: 3
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032819313 Original CRISPR GATGGTGGCCCGTCTGGCTG TGG (reversed) Exonic
900096874 1:943342-943364 GTGGGGGGCCTGTCTGGCTGTGG + Exonic
900184977 1:1328701-1328723 GATGGTGGCTGGGCTGGTTGTGG - Exonic
900341246 1:2190369-2190391 GATGGTGGCCGGCCAGGCAGGGG + Intronic
900977910 1:6028586-6028608 GCTGGTGGCCGCTCTGGGTGCGG + Intronic
901314395 1:8296084-8296106 CATGGTGGCCCCACAGGCTGAGG + Intergenic
902192263 1:14772160-14772182 GAGGGTGTCCCTTCTGGTTGGGG + Intronic
903539671 1:24089892-24089914 CACTGTGGCCCATCTGGCTGTGG - Intronic
904910128 1:33928375-33928397 TATGGTGGCCAGTGAGGCTGTGG + Intronic
905296037 1:36955063-36955085 GTTGGAGGCCCATGTGGCTGAGG - Intronic
905852426 1:41283902-41283924 GAAGGAGGCCGGTCTCGCTGGGG - Intergenic
906253979 1:44333368-44333390 GATTGTGGTCCCTCTGTCTGTGG - Intronic
912866720 1:113264296-113264318 GATGGTGGCCTGGATGGCTAAGG - Intergenic
916436567 1:164783131-164783153 GATGGTGTCGCCTCTGGCTCAGG + Intronic
920386210 1:205571706-205571728 GCTGGTGGAGCTTCTGGCTGGGG - Intronic
921624625 1:217364727-217364749 CATGGTTGCCCCTCTGACTGAGG - Intergenic
923276758 1:232403350-232403372 TATGGTCGCCCGCCTGGCTCAGG + Intronic
924831819 1:247604007-247604029 AATAGTGGCCATTCTGGCTGGGG + Intergenic
1064377155 10:14807417-14807439 GATAATGGCCATTCTGGCTGGGG + Intergenic
1066432253 10:35363064-35363086 GATGGTGGGCCGCCGGGCAGAGG + Intronic
1067084954 10:43233052-43233074 GAAGGTGGCCTGTCGGGGTGGGG - Intronic
1069745089 10:70709993-70710015 GATGGGGACCTGTCTGGGTGAGG + Intronic
1070637921 10:78143976-78143998 GATGCTGGCCCTGCTGGCTGGGG + Intergenic
1073138551 10:101232799-101232821 GATGCTGGCCCAGCTGACTGGGG - Intergenic
1074394472 10:113086212-113086234 TATGGAGGCCAATCTGGCTGAGG + Intronic
1075647120 10:124103923-124103945 GATGGTGTCCCTGCTGCCTGGGG + Intergenic
1078356369 11:10635073-10635095 GATTGAGGCCAGCCTGGCTGGGG + Intronic
1079727554 11:23894743-23894765 GATAATGGCCATTCTGGCTGGGG - Intergenic
1080551947 11:33380048-33380070 GATGGTGGCATTTCTGGCAGAGG + Intergenic
1083828780 11:65217886-65217908 AGTGGTGGCCCTGCTGGCTGTGG + Intergenic
1084211121 11:67623191-67623213 GTTGTTGGATCGTCTGGCTGGGG - Intergenic
1084429187 11:69101905-69101927 GATGGGGCCCTCTCTGGCTGTGG + Intergenic
1084944767 11:72632677-72632699 GCAGGTAGCCCATCTGGCTGTGG - Intronic
1088618062 11:111653153-111653175 CAGGGTGGCCCTTCTGGTTGAGG - Intronic
1089523515 11:119081547-119081569 GCTGGAGGTCAGTCTGGCTGTGG - Exonic
1089668471 11:120035255-120035277 GCTAGTGGCCACTCTGGCTGGGG + Intergenic
1091240194 11:134046936-134046958 GATGGTGACTCACCTGGCTGAGG - Intergenic
1100497019 12:95134995-95135017 GTTGGTGGTCAGTCTGGCTGGGG - Intronic
1102962538 12:117101959-117101981 GGTGGTGGCTTGTTTGGCTGTGG - Intergenic
1104896929 12:132169148-132169170 GAAGGTGGGCCGTGTGGCAGGGG + Intergenic
1104990746 12:132622561-132622583 GACCGTGGCCTGGCTGGCTGTGG - Intergenic
1104992720 12:132635193-132635215 GAAGGGGTCACGTCTGGCTGGGG - Intronic
1108026731 13:46185646-46185668 GATGCTGGGCCAGCTGGCTGGGG + Intronic
1110687168 13:78388756-78388778 GATGGTGGCCCCTTGGCCTGGGG - Intergenic
1112288451 13:98124462-98124484 GCTGGTGGCCACTGTGGCTGGGG - Intergenic
1113834792 13:113321706-113321728 GAAGGTGGCCAGTTTGGCTCTGG + Exonic
1115545729 14:34463157-34463179 GTTGCTGGCCCATCTGGCAGTGG - Intergenic
1122286606 14:100656030-100656052 CAGGGTGGCCCATCTTGCTGGGG + Intergenic
1122615498 14:103015088-103015110 GATGGTGGCCAGGCTGGAAGTGG + Intronic
1125552878 15:40560680-40560702 AATAGTGGCCATTCTGGCTGGGG - Intronic
1129823699 15:78620796-78620818 GCTGGTGGCCGGGCTGGCCGCGG + Exonic
1129958018 15:79656853-79656875 GATGGTGGCTCGTCTGCTTATGG - Intergenic
1132890062 16:2199404-2199426 GCAGGTGGCCACTCTGGCTGGGG + Intergenic
1133064831 16:3198354-3198376 GCTGGTGTGCCATCTGGCTGAGG + Intergenic
1134494840 16:14724704-14724726 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134500223 16:14763824-14763846 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134526765 16:14950436-14950458 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134545641 16:15105912-15105934 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134580356 16:15365226-15365248 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134628727 16:15741522-15741544 GATGGAGGCCCGCCTGGAGGAGG - Exonic
1134714342 16:16348913-16348935 GATGGGGGCCCCACTGGGTGGGG - Intergenic
1134722217 16:16392277-16392299 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134945210 16:18319592-18319614 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134952474 16:18359745-18359767 GATGGGGGCCCCACTGGGTGGGG + Intergenic
1136269130 16:29138284-29138306 GATGGTGTCCCGACAGCCTGGGG + Intergenic
1137476122 16:48811253-48811275 GATGCTGGCCCGTCCAGCAGAGG + Intergenic
1138219765 16:55240644-55240666 GATGTTAGACCCTCTGGCTGAGG - Intergenic
1138592944 16:58012474-58012496 GATGGTGAACAGTCTGCCTGTGG - Intronic
1139956721 16:70696824-70696846 GATGCTGGACCATCTTGCTGGGG - Intronic
1140476143 16:75240072-75240094 CCTGGTGGCCCGTATGGCTGAGG - Intronic
1140576278 16:76173494-76173516 AATAGTGGCCTTTCTGGCTGGGG + Intergenic
1142072614 16:88099556-88099578 GATGGTGTCCCGGCAGCCTGGGG + Intronic
1142239392 16:88938282-88938304 GAATGTGGCCCGGCAGGCTGGGG + Intronic
1143527711 17:7482104-7482126 GCTGGTGGCCCTGCTGGGTGGGG + Exonic
1143565721 17:7719417-7719439 GATGATGGCCAGGCTGGGTGCGG - Intronic
1144360500 17:14487295-14487317 GAAGGGGGCCAGTGTGGCTGGGG + Intergenic
1145358566 17:22188129-22188151 GATCGTAGCCCGTGTTGCTGTGG + Intergenic
1146731047 17:35194166-35194188 GCTGGTGGCCCTGCTGGGTGGGG - Exonic
1147376831 17:40027449-40027471 GACGGAGGCCGGTTTGGCTGTGG + Exonic
1149602004 17:57899150-57899172 GATGGTGTCCCGGCTGCCTGAGG - Intronic
1154115454 18:11609715-11609737 GCTGGTGGCCCTGCTGGGTGGGG + Intergenic
1157241648 18:46015402-46015424 GTTGGTAGACAGTCTGGCTGAGG + Intronic
1161491977 19:4567185-4567207 GGTCGTGCCCCGTATGGCTGAGG - Intergenic
1162377988 19:10316335-10316357 GCTGGTGGCCCAGTTGGCTGGGG + Exonic
1162788927 19:13053193-13053215 GATGGGGGTCAGGCTGGCTGAGG + Intronic
1164878612 19:31711987-31712009 GAGGGTGGCAGGTCAGGCTGCGG - Intergenic
1167798143 19:51724143-51724165 AAGGGAGGCCCGTCTGGCTGAGG - Intergenic
926131173 2:10303805-10303827 GAAGGTGGCGCGTCTGGCCCAGG - Intronic
929053302 2:37855935-37855957 GATGGTGGGCAGCCTGTCTGAGG + Intergenic
937361849 2:121235116-121235138 GATGGTGGGTGGTCTGGCTGGGG - Intronic
938055154 2:128208954-128208976 GATGGTGGGCAGTCAGGCAGAGG - Intergenic
938318238 2:130344767-130344789 GATGGTGCCCGGTGTGTCTGAGG - Intronic
938810969 2:134852485-134852507 GATGGTGGCCTATCAGGCAGAGG + Intronic
939008934 2:136822239-136822261 GGTGGAGGCCGGTCTGGATGGGG - Intronic
948438348 2:237968446-237968468 GATCGGGGCCCCTTTGGCTGGGG + Intronic
1179290585 21:40014618-40014640 GTTGGAGGCACGTCAGGCTGCGG - Intronic
1181313577 22:21958302-21958324 GAGGGTGGCACCACTGGCTGAGG + Intronic
1181346685 22:22224374-22224396 GAGGGTGGCACCACTGGCTGAGG + Intergenic
1181696527 22:24595414-24595436 GCTGCTGGCCCGTCTCCCTGGGG + Intronic
1183948470 22:41339825-41339847 CAGGGTGGCCTGTCTGGCAGCGG + Exonic
1184787679 22:46679835-46679857 GTTGGTGGCCCAGCTGGCTCAGG - Intergenic
954213538 3:49111644-49111666 GCTGGTGACCCCTATGGCTGAGG - Exonic
954218060 3:49135358-49135380 GTAGGTGGCCCCTTTGGCTGTGG - Intergenic
956892218 3:73624213-73624235 GCTGGTGGCCCAGCTGGCCGCGG - Exonic
961382690 3:126505916-126505938 GATGGGGCCACGCCTGGCTGTGG - Intronic
968234491 3:197023657-197023679 GAGCGTGGCCCGACTGGCTCAGG - Intronic
968434854 4:579203-579225 GATGAGGGCCTGTCTGCCTGCGG - Intergenic
968921155 4:3522833-3522855 GAGCGTGGCCCGTCTGTCTCAGG + Intronic
969086685 4:4661994-4662016 GATTGGGGCCAGTGTGGCTGTGG + Intergenic
977354970 4:95934029-95934051 GATGCTGGCCCGTCAGTCTTGGG - Intergenic
980044291 4:127971112-127971134 GAAGGTGGCCTGTGTGCCTGTGG + Intronic
983834848 4:172374013-172374035 GTTGTTGGATCGTCTGGCTGGGG + Intronic
985538859 5:478629-478651 GATGGTGGCTGGTGTGGTTGGGG + Intronic
986474630 5:8115006-8115028 GATGTGGGGCCGGCTGGCTGGGG - Intergenic
986826303 5:11526499-11526521 GGTGCTGGCCCAGCTGGCTGAGG + Intronic
986915747 5:12617692-12617714 GATAATGGCCATTCTGGCTGGGG + Intergenic
990941240 5:61205159-61205181 GATGGTGGGCAGTCGGGCAGAGG - Intergenic
990986049 5:61641970-61641992 GCTGGTGGCAGGTCTGGATGGGG + Intronic
991325077 5:65422273-65422295 AATAGTGGCCATTCTGGCTGGGG - Intronic
996504022 5:124249049-124249071 AATAGTGGCCATTCTGGCTGGGG - Intergenic
997425710 5:133801347-133801369 GATGGTGGTGCCACTGGCTGAGG - Intergenic
998689416 5:144570833-144570855 GATGGTTTCCCTTCTGGCTCAGG + Intergenic
999378666 5:151104702-151104724 GAGGGTGGCCAGTGTGGCTTGGG + Intronic
999736697 5:154518349-154518371 GATTGTGGCCCCATTGGCTGGGG + Intergenic
1001541444 5:172542689-172542711 GATGGTGGCCTCTCCAGCTGGGG - Intergenic
1002639736 5:180625081-180625103 GAGGGTAGCCCCACTGGCTGTGG - Intronic
1006398266 6:33801142-33801164 GATGGTATCCCGTAAGGCTGTGG - Exonic
1007414257 6:41682931-41682953 GATGGTGGCCGGGCTGGCGCAGG - Intergenic
1008920841 6:56843362-56843384 GATGGTGGGCCGCCCGGCTCCGG + Intronic
1009192526 6:60646541-60646563 GCTGGTTTCCCATCTGGCTGTGG - Intergenic
1011623930 6:89268387-89268409 GGAGGTGGCCCTGCTGGCTGAGG - Intronic
1013155859 6:107490504-107490526 GATGGTGGCGAGGCTGGCGGAGG - Exonic
1016824201 6:148373400-148373422 CAAGGTGGCCAGTGTGGCTGGGG + Intronic
1018907819 6:168085505-168085527 CATGGTGGGGCGTGTGGCTGTGG - Intergenic
1018994889 6:168703121-168703143 AATGGTGGCAGGACTGGCTGAGG - Intergenic
1019579325 7:1752277-1752299 CATGGTGGCCCCTCTGGGTGGGG - Intergenic
1032819313 7:135510057-135510079 GATGGTGGCCCGTCTGGCTGTGG - Exonic
1032947459 7:136869897-136869919 GATGGAGGCCCGGCTCGCTCGGG + Intronic
1034424932 7:151009388-151009410 GATGGTGGCCCTCCTGGGGGTGG - Exonic
1035022182 7:155806359-155806381 CATGCTGGCCCGCCTGGCGGTGG - Exonic
1036515566 8:9440340-9440362 GCTGCAGGCCCATCTGGCTGAGG - Intergenic
1036737488 8:11331226-11331248 GCTGGTGGCCCTGCTGGGTGGGG + Exonic
1041623819 8:60002109-60002131 AATGTTGGCCCGTCTAGCTAAGG - Intergenic
1047341999 8:123990405-123990427 AATAATGGCCCTTCTGGCTGGGG + Intronic
1049213412 8:141396964-141396986 GAGGGTAGCCGGGCTGGCTGGGG + Intronic
1052222635 9:26046037-26046059 GATGGTGGCTTGTGTGTCTGTGG - Intergenic
1061919046 9:133772190-133772212 GCTGGTGGCCCGAAGGGCTGGGG - Intronic
1061959797 9:133982205-133982227 GAAGGTGGCCAGTGTGCCTGAGG + Intronic
1185470031 X:376656-376678 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470047 X:376717-376739 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470139 X:377075-377097 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470169 X:377193-377215 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470229 X:377429-377451 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470259 X:377547-377569 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470304 X:377726-377748 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470320 X:377787-377809 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470351 X:377909-377931 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185511330 X:666988-667010 GATGGTGGCTTCTCCGGCTGTGG + Intergenic
1186846981 X:13540523-13540545 GCTGATGGCGGGTCTGGCTGAGG + Intergenic
1194780738 X:98022907-98022929 GGTGGTGGCTCCTCTGCCTGTGG - Intergenic
1198411377 X:136372965-136372987 GACGGTGGCCGGGCTGGCTTTGG + Exonic
1199970150 X:152853691-152853713 GTTGGTGGCCAGTGTGCCTGGGG - Intronic