ID: 1032825160

View in Genome Browser
Species Human (GRCh38)
Location 7:135561582-135561604
Sequence CTCTGTGACTAGAAGTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032825160 Original CRISPR CTCTGTGACTAGAAGTCTGA GGG (reversed) Intronic
904337112 1:29805171-29805193 CTCTGTGTCTGGCAGCCTGATGG + Intergenic
905106178 1:35564871-35564893 CTCTGTGTCCAGAACCCTGAGGG + Intronic
906538935 1:46570114-46570136 CCATGTGACTAGAAGTTGGAGGG - Intronic
907424893 1:54373358-54373380 CTCTGTAACTAGAATCATGAAGG - Intronic
907514664 1:54986085-54986107 CTCTGTGTCCAGATGTGTGACGG + Exonic
907595602 1:55716771-55716793 CTCTGTGACTATAAGTATCATGG - Intergenic
908167741 1:61474945-61474967 CTCTGTGAACAGAAATCTGCAGG + Intergenic
909179806 1:72408736-72408758 CTCTCTGACAGGAAATCTGAAGG - Intergenic
911786496 1:101955951-101955973 CTCTGTGACTTGTAGCTTGATGG - Intronic
914915934 1:151819221-151819243 CTAAGTGACTAGAAGTATGGGGG - Intronic
916432432 1:164744004-164744026 CTAGGTAACTAGAAGTCTGATGG + Intronic
920649995 1:207830633-207830655 CTCATAGAGTAGAAGTCTGATGG + Intergenic
920970456 1:210739066-210739088 CTGTCTGACTAGAACTCTCATGG - Intronic
922052995 1:222012086-222012108 CTCTGTGACTTGCTGTCTGCTGG + Intergenic
922791357 1:228312831-228312853 CTCTGTGACCAGATGTGTGGGGG + Intronic
1064780757 10:18835762-18835784 CACAGTGTCTGGAAGTCTGATGG - Intergenic
1064919818 10:20504192-20504214 ATCTGTTACAAGAAGTCTGGAGG + Intergenic
1064979306 10:21149911-21149933 TTCTGTGACCAGATGTGTGAGGG - Intronic
1065509830 10:26467223-26467245 CTTTGAGAATAGAAGTATGAGGG + Intronic
1067428649 10:46227797-46227819 CCCTGTGACTAGGATTGTGAAGG - Intergenic
1070664260 10:78332363-78332385 CTCTGTTACTTGAAGGCAGACGG + Intergenic
1071928397 10:90437395-90437417 CTCTGTGAACAGATGTGTGAGGG - Intergenic
1072212111 10:93255781-93255803 GTCTGTGAGAAGAAGGCTGAAGG + Intergenic
1072693550 10:97587031-97587053 CCCTGTGGCTAGAAGCCTGAAGG - Intronic
1074415134 10:113261031-113261053 CTCTGTGTCTCCAATTCTGAGGG + Intergenic
1076041484 10:127253354-127253376 TTCTGTGACCAGAAGTGTGTGGG + Intronic
1076503064 10:130952197-130952219 GTCTGTAACTAGAAACCTGACGG + Intergenic
1077046837 11:550411-550433 CTCTGTCACTGGAAGTCTGACGG + Intronic
1078770487 11:14346353-14346375 CTCTGTCACTAGTATTCTCAGGG - Intronic
1081648029 11:44803486-44803508 TTCTGTCATTAGGAGTCTGAAGG + Intronic
1082975011 11:59062768-59062790 CTCTGGGACTTGAAGTCCGCTGG + Intergenic
1082979429 11:59106497-59106519 CTCTGGGACTTGAAGTCCGCTGG + Intergenic
1084604557 11:70164985-70165007 CTCTGTTACTTTAAGTCTGTGGG - Intronic
1086455782 11:86957124-86957146 CTCTGTGCCTAGAACTGTGTTGG + Intergenic
1089396258 11:118137879-118137901 CTCCGTGACTAGAGGTATTAAGG + Intronic
1090021899 11:123136111-123136133 CACTATGACTAGCAATCTGACGG + Intronic
1090277434 11:125429863-125429885 CTCTGTGAAATGGAGTCTGAAGG + Intronic
1090852786 11:130585185-130585207 CTCTGTGACAGGAAGCCCGAGGG + Intergenic
1093658521 12:21725782-21725804 TTCTGTGATAAGATGTCTGAGGG + Intronic
1096799948 12:54103823-54103845 CCCTGTGGATAGAAGTCAGATGG + Intergenic
1097957033 12:65496713-65496735 CTCTATGAGGACAAGTCTGAAGG - Intergenic
1098520378 12:71429280-71429302 CTATGTGACTAGAATTCCCAAGG + Intronic
1099028753 12:77498369-77498391 CTCACTGACTACAAATCTGAGGG - Intergenic
1099923088 12:88983517-88983539 CTCAGTGACTAGAAGTTTGATGG - Intergenic
1103140864 12:118547053-118547075 GTCTGTTAGTAGAAGACTGATGG + Intergenic
1103621496 12:122189904-122189926 CTCTGTGACTCCAACTGTGAGGG + Intronic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1106832633 13:33601790-33601812 CTCTGTGCCCAGAACTGTGAAGG + Intergenic
1107174015 13:37379038-37379060 CTCTGAGACTAACAGTCTTAAGG - Intergenic
1107454325 13:40540272-40540294 CTAAGTGACTAGATGTGTGAAGG - Intergenic
1107548115 13:41452712-41452734 CTCTCTGACTTGCAGTCTTAAGG + Intergenic
1108532101 13:51337101-51337123 CACTGTTAAAAGAAGTCTGAGGG - Intronic
1108660266 13:52578817-52578839 CATTATGATTAGAAGTCTGAAGG + Intergenic
1110488452 13:76073502-76073524 TTCTGTGACTAAATGTGTGAGGG - Intergenic
1110925350 13:81143674-81143696 CTATGTGATCAGATGTCTGAGGG + Intergenic
1111164008 13:84433352-84433374 CTCTGAAGATAGAAGTCTGAGGG + Intergenic
1118306527 14:64659624-64659646 CTATATGACTAGATGTCTCATGG + Intergenic
1120957477 14:90095671-90095693 TTCTGTGACCAGAAGTGTGAGGG + Intronic
1123878614 15:24652072-24652094 CTCTGTGGCTTGAAGACTAATGG + Intergenic
1123894269 15:24812861-24812883 CTCTGTGTCATGAAGACTGATGG + Intergenic
1128083594 15:64871182-64871204 CTCTGTGACTTGAAGTCCTGTGG + Intronic
1129505500 15:76078259-76078281 CTCTGTGACTGTAAGTCGCATGG - Intronic
1129682353 15:77664914-77664936 CTGTGTGTTTACAAGTCTGAAGG - Intronic
1131796629 15:96024320-96024342 CTCTCCAACTAGAAGTATGATGG - Intergenic
1138129419 16:54466997-54467019 CTCTGGGGCTAGAAGTCAGGGGG - Intergenic
1142029646 16:87832134-87832156 CTCTGTTTCTAGAAGACTGAAGG + Exonic
1142188075 16:88703963-88703985 CTCTGTAACCAGAAGCCTGTGGG - Intronic
1144395661 17:14840486-14840508 CTCTGGGAGCTGAAGTCTGAGGG - Intergenic
1144952653 17:19002505-19002527 CTCTGGGACTGGAAGTATAAAGG + Intronic
1145371052 17:22306160-22306182 CTCTGTGGCTAGATTTCTCAAGG - Intergenic
1146986030 17:37219076-37219098 CTGTGTGATTAGAAGGTTGAGGG + Intronic
1147842671 17:43383041-43383063 CTCTGGGACTTGATGACTGAAGG + Intergenic
1151116083 17:71736750-71736772 TTCTGTGATTAGAATTCTGAAGG + Intergenic
1153543579 18:6183216-6183238 CTCTGCGACTACATGTCTGTGGG + Intronic
1153938783 18:9957784-9957806 CACTGGGACTTGAATTCTGATGG + Intronic
1154099028 18:11451488-11451510 CTCTTTAAGTTGAAGTCTGATGG + Intergenic
1156719381 18:40050867-40050889 CTCTGAGATTAGTATTCTGAGGG - Intergenic
1158361921 18:56684205-56684227 TTCTGGGACAAGAAGTATGAGGG + Intronic
1160205572 18:76828512-76828534 CACTGTTACCAGAAGCCTGAGGG - Intronic
1160361325 18:78283858-78283880 ATATGTGACTTGAAGTCAGAAGG + Intergenic
1161093048 19:2372555-2372577 CTCTGAGATTAGCAGTGTGAAGG + Intergenic
1167379084 19:49128284-49128306 CACTGGGACTGGAAGTTTGAAGG - Intronic
1167881065 19:52457702-52457724 CTCTGTGACTAAATGTATGTGGG - Intronic
925783525 2:7405914-7405936 CTCTAAAACTTGAAGTCTGAGGG + Intergenic
926690402 2:15729262-15729284 GTCTGTGACTGGAAGGCAGAAGG + Intronic
929379366 2:41332438-41332460 CTGAGAGACTAGAAGTGTGAAGG - Intergenic
932628353 2:73317205-73317227 TTATGTGTCAAGAAGTCTGAAGG + Intergenic
933116720 2:78482740-78482762 CTCTGTGGCTAGATGTTTTATGG + Intergenic
933946808 2:87293929-87293951 CTTTGGGCCTTGAAGTCTGATGG - Intergenic
936333381 2:111567626-111567648 CTTTGGGCCTTGAAGTCTGATGG + Intergenic
937141145 2:119601919-119601941 TACTCTGACTTGAAGTCTGATGG - Intronic
941424274 2:165322500-165322522 CTCTGTCTCAAGAAATCTGAGGG - Intronic
943148289 2:184074549-184074571 CTCTGTGCCAGGAGGTCTGAAGG + Intergenic
944047394 2:195428687-195428709 ATCTGAGACTAGAAGTCAGGAGG + Intergenic
946438614 2:219676321-219676343 CTCTGGCACTAGAAAGCTGAAGG - Intergenic
947172026 2:227321592-227321614 CTCTGTGTCTAGTAATCTGGTGG + Intergenic
1169501105 20:6161548-6161570 CTCTGTGACCTGTATTCTGATGG + Intergenic
1172046459 20:32084084-32084106 ATCCGTGACTAGGAGTCTGTGGG - Intronic
1173148565 20:40546422-40546444 CTCTGTGAGTACAAGGATGAGGG + Intergenic
1177073740 21:16545620-16545642 CTCTTTGCCTAGAAGAATGAGGG - Intergenic
1177451316 21:21270821-21270843 TTCTGTGGCTTGATGTCTGATGG + Intronic
1178459897 21:32793463-32793485 CTCTGCAACTAGAAGCCTGCAGG - Exonic
1181034955 22:20165436-20165458 CTCTGTGACCAGCAGCCTCAGGG - Intergenic
1181714271 22:24712860-24712882 CTCTGGGGCTTGAAGTCTTAGGG - Intergenic
1183056512 22:35309906-35309928 CTCTGTGGCCAGAAGTCCCAGGG + Intronic
1183659857 22:39212931-39212953 CTCTGTGTCAAGAAGCCTAAGGG + Intergenic
1183706476 22:39477771-39477793 CACTGTTACTGGAAGTCTGGAGG - Intronic
1184019234 22:41809428-41809450 CTCTGTGACCAGTGCTCTGATGG + Intronic
1184200500 22:42965486-42965508 CTCTGTTACTAGACTTCTGCTGG - Intronic
950859791 3:16137802-16137824 CTCTGAACCTAGAAGTCTAACGG - Intergenic
952145498 3:30527409-30527431 CTCAGTGATTAGAACTCGGAGGG + Intergenic
952961744 3:38596388-38596410 CTCAGTGGGTAGAAGTCTCATGG - Intronic
953472688 3:43180471-43180493 CTCTGTGGCCAGAAGTCTCCTGG + Intergenic
954633840 3:52060983-52061005 CTAGGTGACTAGAGGGCTGAGGG - Intergenic
954727469 3:52625902-52625924 CTGTGTGGCTAGTAGTCTGTGGG - Intronic
955399307 3:58579897-58579919 CCCTGGGGCTAGCAGTCTGATGG - Intronic
960157583 3:114311796-114311818 CTCTGGGACTAAAACTCTGATGG + Intergenic
960602841 3:119475090-119475112 CTCAGGGACTAGCAGTCTGAGGG - Intronic
960814640 3:121660106-121660128 CTCTGTGACTAAGCCTCTGAGGG + Intronic
961074771 3:123971979-123972001 CTCTGTGCCTACATGTCTGGTGG - Intronic
961308913 3:125980507-125980529 CTCTGTGCCTACATGTCTGGTGG + Intronic
961614762 3:128170030-128170052 ATCTGTGCCTGGAAGTGTGAAGG + Intronic
963798886 3:149657903-149657925 CTCTGTGCCTGGCAGTCTAAGGG + Intronic
964271592 3:154962130-154962152 CTTTGTGTCTAGAAGTACGAGGG - Intergenic
967993972 3:195153027-195153049 CTCTGTGGGAAGCAGTCTGACGG + Intronic
969220875 4:5757628-5757650 CTCTGTGCTTGGAAGACTGAAGG + Intronic
970295131 4:14620988-14621010 GTCTCTGGCTGGAAGTCTGAGGG - Intergenic
971826056 4:31623916-31623938 CTATGTCACTAGAACTCTGAGGG + Intergenic
974713637 4:65636898-65636920 CCCAGTGCCTAGAAGACTGAGGG + Intronic
974915814 4:68176962-68176984 CTCTGTGATTAGGATTGTGAAGG + Intergenic
976772823 4:88672866-88672888 CACTGTGACTAGCAGGCAGATGG - Intronic
977772101 4:100871504-100871526 TTCTGCCAGTAGAAGTCTGAGGG - Intronic
978167396 4:105625419-105625441 CTCTATGTGTAAAAGTCTGAAGG + Intronic
978389263 4:108207217-108207239 CTCTTTGCCTGGATGTCTGAAGG - Intergenic
981178905 4:141716017-141716039 CTGTGTGACTACGAGTCTAAGGG + Intronic
981203825 4:142015580-142015602 CTCTGTGACTAGATGACTTCAGG - Intergenic
982054024 4:151529566-151529588 CCCTGTGACTAGCAGGTTGATGG + Intronic
982125872 4:152183342-152183364 CCCTGTGATTAGAAGACTGTGGG - Intergenic
985746295 5:1650452-1650474 CTCAGTGTCTAGAGGTCTTACGG + Intergenic
987108779 5:14665168-14665190 CTGTGTGACCAGAATTGTGAGGG - Intronic
988028771 5:25735167-25735189 CTCTCTGACTGCAAGTCAGAGGG + Intergenic
989619313 5:43368861-43368883 TTCAGAGTCTAGAAGTCTGAAGG - Intergenic
989812945 5:45699259-45699281 ATCGGTGACTTGAAGTTTGATGG + Intergenic
991536119 5:67670849-67670871 CTTTGTGACTACAACTCTAAAGG - Intergenic
992337920 5:75792503-75792525 ATATGTGAGTAGAGGTCTGATGG + Intergenic
998400787 5:141848060-141848082 CTCTCTGACTCCAAGTTTGATGG + Intergenic
999632837 5:153588199-153588221 CTCTGTGTCTAGATATTTGAGGG + Intronic
1000597282 5:163230419-163230441 CTTTGTGCCAAGAAGTCAGAAGG - Intergenic
1001012856 5:168114347-168114369 CTCTGTGCCAAGAAGTATTACGG - Intronic
1001050748 5:168412179-168412201 CTCTGTGATGAGAAGTCTAATGG - Intronic
1001769120 5:174279520-174279542 CTCTGTGAGAAGCAGTCTGGTGG + Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1005268865 6:24141772-24141794 CTCTGTGTTCAGCAGTCTGATGG + Intronic
1005485342 6:26294027-26294049 CTCTCTGCCCAGAGGTCTGATGG + Intergenic
1005755999 6:28925371-28925393 CCATGGGACAAGAAGTCTGAGGG + Intergenic
1007786881 6:44285655-44285677 CTCTGTAGCTAACAGTCTGATGG - Intronic
1008326882 6:50192948-50192970 CACTGAGACTAGAAATCTGCAGG - Intergenic
1008344691 6:50412159-50412181 CAATGTGAATAGAAGCCTGAAGG + Intergenic
1008441041 6:51532092-51532114 ATCTGTGACTAGTGGTCTCATGG + Intergenic
1011755050 6:90490121-90490143 ATCTGTGACTAGAACAATGAAGG - Intergenic
1012603331 6:101126181-101126203 CTCTGTGAATAGAAGAAAGAAGG - Intergenic
1012981225 6:105832099-105832121 ATGTGTGACTAGATGTCTCAAGG + Intergenic
1015454016 6:133404605-133404627 CTCTATGACTAGAAGACTGTGGG - Intronic
1015788462 6:136942533-136942555 CTCTGTGACAATGATTCTGATGG - Intergenic
1017266754 6:152455019-152455041 CTGTGTCACTTGAAGTCTGGTGG - Intronic
1017818394 6:158031342-158031364 CTCTGTGGCTGGAGGTGTGAGGG + Intronic
1018283780 6:162216039-162216061 CTCTGTCACAAGAAAACTGAAGG + Intronic
1022321645 7:29293501-29293523 AACAGTGACCAGAAGTCTGAGGG - Intronic
1023603598 7:41906247-41906269 CTCTCTGATGACAAGTCTGAAGG + Intergenic
1026933140 7:74236278-74236300 CTCTGTGCCCACAAATCTGAAGG + Intronic
1027908692 7:84219062-84219084 AGCTGTTACTAGAAGTCAGAGGG - Intronic
1029654898 7:101917806-101917828 CTCGGTGACCATATGTCTGAGGG + Intronic
1031325728 7:120394733-120394755 CTGTGAGACTAGAAGTAAGATGG + Intronic
1031900113 7:127399584-127399606 GTTTGGGACTAGAAGACTGATGG - Intronic
1031965582 7:128025941-128025963 GTCTGTGGCTAACAGTCTGAGGG - Intronic
1032825160 7:135561582-135561604 CTCTGTGACTAGAAGTCTGAGGG - Intronic
1032982661 7:137301939-137301961 GTCAGTTACTAGAAGTCTTAAGG - Intronic
1034260248 7:149751002-149751024 CTCTGTGAGGAGATGTCCGAAGG - Intergenic
1036292706 8:7507879-7507901 TTCTATGACTAAAAGTCTGAAGG + Intronic
1036329856 8:7813134-7813156 TTCTATGACTAAAAGTCTGAAGG - Intronic
1036606044 8:10306617-10306639 CTCTGTGAGAAGAAGCCTTAAGG - Intronic
1037589621 8:20302304-20302326 GTCTGTGGGTAGAAGTCTGTGGG - Intronic
1038374269 8:27022824-27022846 CTCTGTGACTAGATGTGTGGGGG + Intergenic
1038620082 8:29134228-29134250 CTCTGTGTTTTGAAATCTGAGGG + Intronic
1040871361 8:52102699-52102721 CTCTCTGACAAGAAGTCAGCTGG - Intergenic
1041461694 8:58118632-58118654 CTTTGTAACTAAAAGTGTGAAGG - Intronic
1047734760 8:127755454-127755476 CTCTGTGGCTAGAAGAGGGAAGG - Intergenic
1050435839 9:5609485-5609507 CTCTGTGACTACTAATCTGGGGG + Intergenic
1050928770 9:11298893-11298915 CTCTGAGAATAGAAGCCTGTGGG + Intergenic
1058971404 9:110086693-110086715 CTCTGTGTCCAGAAACCTGATGG - Intronic
1059268194 9:113055796-113055818 TTCTGTGACTAGAAGTCTAAGGG - Intronic
1060671131 9:125470855-125470877 CTCTGGAACTAGAAGTCAGTGGG - Intronic
1196026877 X:111050628-111050650 GGCTGGGCCTAGAAGTCTGAGGG - Intronic
1201583990 Y:15540597-15540619 CTATGTGACTGGCAGTCTGGGGG - Intergenic