ID: 1032826240

View in Genome Browser
Species Human (GRCh38)
Location 7:135571385-135571407
Sequence GTTTAGGGGTACATGTCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032826240_1032826246 22 Left 1032826240 7:135571385-135571407 CCTGATGACATGTACCCCTAAAC 0: 1
1: 0
2: 2
3: 11
4: 78
Right 1032826246 7:135571430-135571452 AGGGTCTAACTTTGTAGCCCAGG 0: 1
1: 21
2: 1209
3: 16773
4: 74187
1032826240_1032826245 3 Left 1032826240 7:135571385-135571407 CCTGATGACATGTACCCCTAAAC 0: 1
1: 0
2: 2
3: 11
4: 78
Right 1032826245 7:135571411-135571433 TAAAAAAAAAAAAAAAGACAGGG 0: 12
1: 552
2: 5556
3: 53306
4: 80328
1032826240_1032826244 2 Left 1032826240 7:135571385-135571407 CCTGATGACATGTACCCCTAAAC 0: 1
1: 0
2: 2
3: 11
4: 78
Right 1032826244 7:135571410-135571432 TTAAAAAAAAAAAAAAAGACAGG 0: 15
1: 369
2: 3415
3: 21988
4: 84999

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032826240 Original CRISPR GTTTAGGGGTACATGTCATC AGG (reversed) Intronic
911659561 1:100485933-100485955 GATAAGGTGTACATTTCATCAGG - Intronic
915336612 1:155146789-155146811 CTTTTGGGGAACATGTCATCAGG + Intergenic
915745869 1:158157248-158157270 CATTTGGGGCACATGTCATCAGG + Intergenic
918024757 1:180732666-180732688 GTCTAGGGGTAAATGTCGACAGG + Intronic
918924152 1:190758708-190758730 TTTTGGGGGTACATGTGATTAGG + Intergenic
918980126 1:191546586-191546608 GTTCAGGGGTACATGTGCTGGGG - Intergenic
922199415 1:223389475-223389497 GTTTGAGGGTTCATGTCATGGGG - Intergenic
922685487 1:227635733-227635755 CTTCAGGGGTACGTGTCTTCTGG + Intronic
924794935 1:247286296-247286318 CCTCAGGGGTACATGTCTTCCGG - Intergenic
1070022297 10:72598833-72598855 GATTAGGGTTACATTTCATGGGG - Intronic
1070223636 10:74477340-74477362 GTTTACGGGTGCATGCCACCAGG + Intronic
1074258716 10:111830389-111830411 TTTTTGGGGTACATTTAATCAGG - Intergenic
1081600074 11:44486839-44486861 CTTCAGGGGTACGTGTCTTCCGG - Intergenic
1086669898 11:89533452-89533474 GTTTAGGGTTACATGACATAAGG + Intergenic
1096912078 12:54994582-54994604 GTTCAGGGGTACATGTTACATGG + Intergenic
1098056586 12:66512808-66512830 CTTTAAGTGTACATCTCATCAGG - Intronic
1098452448 12:70635149-70635171 GTTTAGGGGTAGATATCTTTTGG - Intronic
1100089041 12:90947770-90947792 CTTCAGGGGTACATGTCTTCCGG - Intronic
1102495649 12:113317072-113317094 GTTTAGGGGTGCAAGTGTTCAGG + Intronic
1110144331 13:72170751-72170773 CTTTAGGGGCACATGTCTTCCGG + Intergenic
1110181780 13:72626035-72626057 GTTGAGTCGTACAGGTCATCAGG - Intergenic
1114773756 14:25458078-25458100 CTTCAGGGGTACGTGTCTTCCGG - Intergenic
1119591732 14:75895109-75895131 TTTTAGGGGCACATGTTCTCAGG + Intronic
1122360685 14:101160358-101160380 CTTTAGGGGTACGTGTCTTCCGG - Intergenic
1124396117 15:29303482-29303504 GTTTAGGGACACATGTTATAGGG + Intronic
1128925386 15:71650640-71650662 TTTCAGGGGTACGTGTCTTCCGG - Intronic
1131324601 15:91430162-91430184 CTTCAGGGGTACGTGTCTTCCGG - Intergenic
1136127988 16:28199233-28199255 TTTTAGGGGCACATGTCATCAGG - Intronic
1138002491 16:53296377-53296399 GTTTGGGGACACATGTCATCAGG + Intronic
1140778518 16:78272923-78272945 GTTTAGGAGTGCTTGTCATTAGG + Intronic
1141054221 16:80802341-80802363 GTTTAGGGGTGAAAGTGATCTGG - Intronic
1144009743 17:11135602-11135624 CTGTAGGGCTCCATGTCATCTGG + Intergenic
1145932912 17:28698772-28698794 GTCTAGGGCTTCCTGTCATCTGG - Intronic
1146431097 17:32795758-32795780 CTTTAGGAGTACTTGTCTTCAGG - Intronic
1155574063 18:27225918-27225940 CTTCAGAGGTACATGTCTTCCGG - Intergenic
1155804208 18:30145381-30145403 TTTCAGGGGTACGTGTCTTCAGG - Intergenic
1157918968 18:51696748-51696770 CTTCAGGGGTACATGTCATCTGG - Intergenic
1158251612 18:55494622-55494644 GTTTAAGGATGCAAGTCATCAGG + Intronic
1160106723 18:75984655-75984677 GTTTAGGGGTACCAGGCAACAGG + Intergenic
1161189287 19:2944329-2944351 GTTTTGGGGGACAGGTGATCAGG - Intronic
1163016098 19:14455720-14455742 AATTGGGGGTACATGTCATCAGG + Intronic
1163938761 19:20474199-20474221 CTTCAGGGTTACATGTCTTCTGG + Intergenic
1165291306 19:34888346-34888368 CTTTAGGGGTATATGACACCAGG - Intergenic
1168275532 19:55275977-55275999 GATTACAGGTGCATGTCATCAGG - Intronic
1168419127 19:56189739-56189761 CTTTATGTGTATATGTCATCTGG + Exonic
926278708 2:11426389-11426411 CTTCAGGGGTACATGTCTTCCGG - Intergenic
930563814 2:52994808-52994830 GTTTGGGGGTACATGTGAAGGGG - Intergenic
931284503 2:60820706-60820728 GTTTAGGGCCACAGGTCTTCAGG + Intergenic
931815969 2:65901058-65901080 GTTCACAGGTCCATGTCATCAGG - Intergenic
934966031 2:98723339-98723361 CTTCAGGGGTACGTGTCTTCCGG - Intronic
937897923 2:126992407-126992429 TTTTAGGGGTTCATGTGATTTGG + Intergenic
939741005 2:145906305-145906327 ATTTTGTGGTACATCTCATCTGG + Intergenic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
1171172056 20:23024155-23024177 CTTCAGGGGTACCTGTCTTCCGG + Intergenic
1171172218 20:23025729-23025751 CTTCAGGGGTACGTGTCTTCTGG + Intergenic
1182656153 22:31891733-31891755 GTCTGGGGGTACATGTTCTCAGG + Intronic
958062540 3:88502919-88502941 GTTTAGGGTCAAATGTCATTGGG - Intergenic
961970150 3:130954957-130954979 GTTTTGGTTTACATTTCATCTGG + Intronic
973051705 4:45607078-45607100 CTTCAGGGGTACCTGTCTTCTGG - Intergenic
973052710 4:45613865-45613887 CTTCAGGGGTACGTGTCTTCCGG - Intergenic
979868223 4:125782595-125782617 GTTTTGGCTTACATGCCATCAGG + Intergenic
983943039 4:173556375-173556397 CTTTAGAGGGACATGTCAGCTGG - Intergenic
986680736 5:10231015-10231037 GTTTGGGTGTACATGACATCAGG - Intronic
989586202 5:43075496-43075518 CTTCAGGGGTACGTGTCTTCTGG + Intronic
995067116 5:107874978-107875000 CTTTTGGGGCACATGTCATGTGG + Intronic
999413524 5:151374164-151374186 CTTCAGGGGTACGTGTCTTCTGG - Intergenic
1002581227 5:180210458-180210480 GTTTTGGGCCACATCTCATCAGG - Intergenic
1006275219 6:32999907-32999929 CTTTATGCGGACATGTCATCAGG + Intergenic
1012727179 6:102829038-102829060 GTTTATAGGTACAGGTCTTCAGG + Intergenic
1015260688 6:131234826-131234848 GTTTTGGGCTACTTGTCATGTGG + Intronic
1015530455 6:134216674-134216696 ATTTAGAGGTACATGATATCGGG - Intronic
1016291932 6:142536634-142536656 CTTCAGGGGTACGTGTCTTCCGG - Intergenic
1016319187 6:142823319-142823341 GTTTAGGGTTACAGGACATCTGG - Intronic
1019353556 7:567176-567198 TTTTAGGGGTACAGTTCAGCTGG - Intronic
1019845882 7:3500302-3500324 TGTTAGTGGAACATGTCATCTGG + Intronic
1021218887 7:17951278-17951300 ATATAGGGGCACATGTCATCAGG + Intergenic
1027344402 7:77242315-77242337 GCTGAGGGTCACATGTCATCTGG + Intronic
1028088931 7:86673064-86673086 GTTTAGGGCTCCAGGTGATCTGG + Intronic
1029803334 7:102973365-102973387 CTTCAGGGGTACGTGTCTTCCGG - Intronic
1032826240 7:135571385-135571407 GTTTAGGGGTACATGTCATCAGG - Intronic
1037187459 8:16081128-16081150 GGTTAGGGATACATGTTATTAGG + Intergenic
1037895391 8:22649185-22649207 ATTTTGGAGTACACGTCATCAGG + Intronic
1043432079 8:80204920-80204942 ATTTAAGGGTACATGTCAAAAGG + Intronic
1047241068 8:123088588-123088610 TTTTAGGGGCACATGTTCTCAGG - Intronic
1048716918 8:137281451-137281473 CTTCAGGGGTACGTGTCTTCTGG - Intergenic
1053245150 9:36528762-36528784 GTTTTGGGATACATACCATCTGG - Intergenic
1055747153 9:79461179-79461201 ATTTTGTGGTAAATGTCATCAGG - Intergenic
1189028236 X:37421680-37421702 TTTTAGGGGCACATGTTCTCAGG + Intronic
1193024983 X:76837233-76837255 GTTCAGGGGTACATGTTGTGTGG - Intergenic
1195335007 X:103844109-103844131 GTTTTGGGGGACATTGCATCTGG + Intergenic
1200209543 X:154341231-154341253 GTGTAGGGTTTCCTGTCATCGGG - Intergenic
1200221333 X:154390897-154390919 GTGTAGGGTTTCCTGTCATCGGG + Intronic