ID: 1032831143

View in Genome Browser
Species Human (GRCh38)
Location 7:135627657-135627679
Sequence AAAGCTTCCTTGGGCCATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032831143_1032831146 0 Left 1032831143 7:135627657-135627679 CCTATATGGCCCAAGGAAGCTTT 0: 1
1: 0
2: 0
3: 20
4: 211
Right 1032831146 7:135627680-135627702 AGAGAAGAATAAAAATGTTTTGG 0: 1
1: 0
2: 9
3: 111
4: 1095

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032831143 Original CRISPR AAAGCTTCCTTGGGCCATAT AGG (reversed) Intronic
901304943 1:8226093-8226115 TTGGCTTCCCTGGGCCATATTGG - Intergenic
901366874 1:8759933-8759955 AAATCTTCCTTTTCCCATATAGG - Intronic
903715095 1:25359432-25359454 TTGGCTTCCCTGGGCCATATTGG + Intronic
904488291 1:30842222-30842244 AAATCTTCCTAGGGCCCTCTGGG - Intergenic
906390981 1:45416023-45416045 TTGGCTTCCCTGGGCCATATTGG - Intronic
906833235 1:49057108-49057130 AAAGCTTAATTGGGCCAGAGTGG + Intronic
908091818 1:60694200-60694222 TTGGCTTCCTTGGGCCACATTGG - Intergenic
908189978 1:61692259-61692281 AAAGCTTACTTTAGCAATATGGG + Intronic
909389173 1:75098683-75098705 TTGGCTTCCTTGGGCCACATTGG - Intergenic
909475965 1:76081204-76081226 TTGGCTTCCTTGGGCCACATTGG + Intronic
911651773 1:100397111-100397133 TTAGCTTCCCTGGGCCACATTGG - Intronic
912022290 1:105120317-105120339 AAAGCTGGCTTGGGCCTTAAGGG - Intergenic
913359711 1:117966753-117966775 AAAGCTACCTTGTGTCTTATAGG - Exonic
917506445 1:175631560-175631582 TTAGCTTCCTTAGGCCACATTGG - Intronic
918434567 1:184498160-184498182 AGAGCTGCCTTTGGCCAGATGGG - Intronic
919005248 1:191890782-191890804 AAAGCTGTCCTGGGCCACATTGG + Intergenic
919736323 1:200954162-200954184 TTGGCTTCCCTGGGCCATATTGG + Intergenic
919952356 1:202377046-202377068 TTGGCTTCCTTGGGCCACATTGG - Intronic
920013496 1:202887417-202887439 TTGGCTTCCCTGGGCCATATTGG - Intronic
920123894 1:203678293-203678315 AAAGATTCCTTGGACAAAATTGG + Intronic
920716032 1:208341240-208341262 GAGGCTTCCATGGGCCACATGGG - Intergenic
921432143 1:215078033-215078055 TTGGCTTCCTTGGGCCACATTGG + Intronic
921526567 1:216225527-216225549 AAAGCTTCCCATGGCCATATGGG - Intronic
922093822 1:222423903-222423925 AAAGCTAACTTGGGTCATAAAGG - Intergenic
922641346 1:227234988-227235010 TTGGCTTCCTTGGGCCACATTGG - Intronic
924822009 1:247502235-247502257 AAAGATTCCTTGGGTCCAATGGG + Intergenic
1064626697 10:17268383-17268405 AATGCCCCCTTGGGCCAAATGGG + Intergenic
1065796427 10:29312459-29312481 TTGGCTTCCCTGGGCCATATTGG - Intronic
1065991016 10:31010453-31010475 AAAGTTTCCATGGGCCACTTAGG - Intronic
1068215452 10:53977240-53977262 TTAGCTTCCTTGGGCCACATTGG + Intronic
1071555031 10:86594968-86594990 TTAGCTTCCCTGGGCCACATGGG - Intergenic
1071793026 10:88976119-88976141 TTAGCTTCCCTGGGCCACATTGG + Intronic
1072443486 10:95477772-95477794 TTGGCTTCCCTGGGCCATATTGG + Intronic
1078061324 11:8046830-8046852 TTGGCTTCCTTGGGCCACATTGG + Intronic
1078583273 11:12557082-12557104 AGAGCATCCTTGGGCCAAAGAGG - Intergenic
1079002828 11:16772137-16772159 AGAGCTTCCTGGGGACTTATGGG - Intergenic
1080856817 11:36119019-36119041 TTGGCTTCCCTGGGCCATATTGG + Intronic
1083598119 11:63929455-63929477 AAAGATTACTGGGGCCATGTTGG + Intergenic
1084410670 11:69004441-69004463 AAAACTTCCGTTGGCCACATTGG + Exonic
1086099474 11:83083793-83083815 CTGGCTTCCTTGGGCCACATTGG + Intergenic
1086226988 11:84524022-84524044 TTGGCTTCCTTGGGCCACATTGG + Intronic
1087200984 11:95344485-95344507 TTGGCTTCCCTGGGCCATATTGG - Intergenic
1087532896 11:99406879-99406901 AAAGAGCCCTTGGGCCATAAGGG - Intronic
1087926998 11:103930195-103930217 AAAACTTCCTTTGGACATACTGG + Intronic
1089347465 11:117799612-117799634 AAAGCTTCCTTTTGCCAGAGGGG - Intronic
1091173137 11:133536229-133536251 CCAGCTTCCTAGGGCCAGATGGG + Intergenic
1092648584 12:10607442-10607464 AAAGCATACTTAGGCCATAATGG + Intronic
1092962920 12:13613277-13613299 AAAGTTTCCCTGGGCCTAATGGG - Intronic
1093662949 12:21778024-21778046 TTGGCTTCCCTGGGCCATATTGG - Intergenic
1094800756 12:34031951-34031973 TTGGCTTCCCTGGGCCATATTGG - Intergenic
1097988314 12:65807608-65807630 AAAGCTTGCTGGGGTTATATGGG - Intergenic
1098064172 12:66594561-66594583 TTAGCTTCCCTGGGCCACATTGG - Intronic
1098162924 12:67664288-67664310 TAAGCTTCCTTGAGACACATGGG - Exonic
1099197659 12:79638157-79638179 CAAGCTTTCTGGGGCAATATTGG - Intronic
1101531414 12:105576720-105576742 AAAGCTTCCTAATGCCACATTGG - Intergenic
1102837615 12:116080100-116080122 TTGGCTTCCCTGGGCCATATTGG - Intronic
1103285746 12:119799912-119799934 TTGGCTTCCTTGGGCCACATGGG - Intronic
1106274704 13:28193003-28193025 TTGGCTTCCTTGGGCCACATTGG + Intronic
1106622776 13:31387298-31387320 TTGGCTTCCTTGGGCCACATTGG - Intergenic
1106788863 13:33134195-33134217 TTGGCTTCCTTGGGCCATATTGG + Intronic
1107287766 13:38814971-38814993 AAACCTTCCCTGGGCCAGAGGGG - Intronic
1111275583 13:85941539-85941561 AAATCTTCCTTTGGCTAAATTGG - Intergenic
1111483193 13:88859897-88859919 AAAGCTTACTGGGACCATTTTGG + Intergenic
1112982353 13:105400751-105400773 ACACTTTCCTTGGGCAATATTGG + Intergenic
1113128322 13:107005889-107005911 AAAGCTTTCTTGGGCAAGAAAGG + Intergenic
1116354849 14:43914910-43914932 AGACCTTCCTTGGGCCAGAGGGG + Intergenic
1116991130 14:51277956-51277978 AAAGCTGCCCTGGGCCTCATGGG - Intergenic
1118237364 14:64020251-64020273 TTGGCTTCCCTGGGCCATATTGG + Intronic
1118987082 14:70765670-70765692 TCGGCTTCCCTGGGCCATATTGG + Intronic
1120523706 14:85553395-85553417 TTGGCTTCCTGGGGCCATATTGG + Intronic
1122091841 14:99346124-99346146 AATGCTTCCTGTGGCCATCTCGG + Intergenic
1124365672 15:29069740-29069762 AGAGCTACCCTGTGCCATATGGG + Intronic
1126011457 15:44306456-44306478 AAAGTTTCCATGGTCCAGATAGG - Intronic
1126066807 15:44832026-44832048 TTGGCTTCCTTGGGCCACATTGG - Intergenic
1126093024 15:45068529-45068551 TTGGCTTCCTTGGGCCACATTGG + Intronic
1128225662 15:65999581-65999603 AATGCTTCCTCAGGTCATATGGG - Intronic
1132320863 15:100924153-100924175 AGAGCCTCCTTGAGCCATCTTGG + Intronic
1132838548 16:1967005-1967027 AAGGTTTCCTTGTACCATATGGG - Intronic
1133367620 16:5223386-5223408 TAAGCTTCCTTGAGCCCTTTTGG - Intergenic
1135850680 16:25960231-25960253 AAAGCTTCCTGAGGCCTTACCGG + Intronic
1137331974 16:47506730-47506752 TTGGCTTCCCTGGGCCATATGGG + Intronic
1137661050 16:50206677-50206699 AAAGCTCCCTTGTGCCTTCTAGG - Intronic
1137675027 16:50299891-50299913 AGAGCTTCCTTGGGGCACAGGGG - Intronic
1137690211 16:50421087-50421109 AAAGATTCTTGGGGCAATATGGG - Intergenic
1143399044 17:6629097-6629119 AAAGCTTCAATGGGTTATATTGG - Intronic
1146975056 17:37104039-37104061 TTGGCTTCCTTGGGCCACATTGG + Intronic
1148815334 17:50323929-50323951 TTGGCTTCCTTGGGCCACATTGG - Intergenic
1150699083 17:67432146-67432168 TTGGCTTCCTTGGGCCACATTGG + Intronic
1151138129 17:71967125-71967147 ATTGCTTCCTTGGGACAGATAGG + Intergenic
1151648967 17:75453913-75453935 TAGGCTTCCCTGGGCCATGTTGG - Intronic
1153038232 18:785228-785250 TTGGCTTCCCTGGGCCATATTGG - Intronic
1153363327 18:4224439-4224461 AGACCTGCCCTGGGCCATATGGG + Intronic
1156694648 18:39752608-39752630 AAAGCATCTTTGGGGCATTTTGG - Intergenic
1157958040 18:52120955-52120977 TTGGCTTCCCTGGGCCATATTGG + Intergenic
1159115650 18:64110046-64110068 TTGGCTTCCATGGGCCATATTGG - Intergenic
1159253606 18:65915660-65915682 ATTGTTTGCTTGGGCCATATGGG - Intergenic
1159508731 18:69368314-69368336 TTGGCTTCCTTGGGCCATATTGG + Intergenic
1160205820 18:76830556-76830578 TCAGCTTCCCTGGGCCACATTGG + Intronic
1162580450 19:11526700-11526722 AAAGCTCCCTCTGGCCATAGTGG - Intronic
1164527743 19:29024190-29024212 CAAGCTATCTTGGGCCATGTGGG - Intergenic
1168329982 19:55562479-55562501 GCGGCTTCCTTGGGCCACATTGG - Intergenic
925296644 2:2781389-2781411 AAAGCTTCCTGGGGCCAGGGAGG - Intergenic
925418621 2:3692282-3692304 TTAGCTTCCCTGGGCCACATTGG + Intronic
925753106 2:7107636-7107658 AAAGCTTGGTTTGGCCATAGAGG + Intergenic
927297949 2:21476767-21476789 TTGGCTTCCCTGGGCCATATTGG + Intergenic
929858545 2:45655428-45655450 TAGGCTTCCCTGGGCCACATCGG - Intronic
931419045 2:62109001-62109023 ACAGCTTGCTGGGGCAATATGGG - Intronic
932321710 2:70827349-70827371 AAAGTTGCCTTGGGACAGATAGG + Intergenic
932750515 2:74368779-74368801 ACAGCTTCCTTCGGCCAGGTGGG - Exonic
933608410 2:84408401-84408423 AAGGCTTCCCTGGGCCACATTGG + Intergenic
937513005 2:122619679-122619701 AAAGTATTCTTGGGGCATATGGG - Intergenic
940896778 2:159088757-159088779 TTGGCTTCCTTGGGCCACATTGG - Intronic
941527560 2:166625136-166625158 TAAGTTGCTTTGGGCCATATGGG + Intergenic
944023078 2:195128917-195128939 AAAGGTTGCTTGGGCTATGTGGG - Intergenic
945166396 2:206951629-206951651 AAAGTGTCCATGGGCCATACTGG - Intronic
946494514 2:220182261-220182283 TCAGCTTCCCTGGGCCACATTGG - Intergenic
947094786 2:226553664-226553686 AAATCTTCCTTGTGACATCTCGG + Intergenic
947469481 2:230387381-230387403 ATTGGTTCCTTGGGCCATTTGGG + Intronic
947922597 2:233891262-233891284 TCAGGTTCCTTGGGCCACATTGG - Intergenic
948436996 2:237960641-237960663 AAAGCTTTATTGGGCCTTTTGGG - Intergenic
1169071358 20:2733735-2733757 TTGGCTTCCGTGGGCCATATTGG + Intronic
1169792883 20:9429972-9429994 TTGGCTTCCTTGGGCCACATTGG + Intronic
1169794651 20:9448694-9448716 TTGGCTTCCTTGGGCCACATTGG - Intronic
1169970915 20:11268677-11268699 TTGGCTTCCTTGGGCCACATTGG - Intergenic
1170073173 20:12390861-12390883 AATACTGCATTGGGCCATATAGG + Intergenic
1170930501 20:20765973-20765995 AAAGCTCCCCTGCCCCATATGGG - Intergenic
1173445376 20:43112752-43112774 AAAGTCTCCCTGGGCCATATGGG - Intronic
1173597265 20:44266868-44266890 TTGGCTTCCTTGGGCCACATTGG + Intronic
1177707957 21:24733704-24733726 ACAGCTTCCTTGAGCCTTGTGGG + Intergenic
1178866117 21:36328802-36328824 TTAGCTTCCCTGGGCCACATTGG + Intronic
1180297492 22:10956071-10956093 TTAGCTTCCTTGGGCCACAATGG - Intergenic
1181984335 22:26789207-26789229 AAAGCTTCCTCTGGCTATAGGGG + Intergenic
1182268948 22:29141143-29141165 AATGCTGCCTTTGGCCACATTGG + Intronic
950210240 3:11117714-11117736 AAAGCTTTCTTGGGACATCTGGG + Intergenic
951953007 3:28222178-28222200 AATTCTTTCTTGGCCCATATAGG - Intergenic
952047205 3:29337317-29337339 ACAGATTACTAGGGCCATATAGG - Intronic
952759570 3:36902034-36902056 TTGGCTTCCCTGGGCCATATTGG + Intronic
952929543 3:38348303-38348325 AAAGATTCCTTGAGACATGTGGG + Intronic
953100608 3:39822537-39822559 TTGGCTTCCTTGGGCCATATTGG - Intronic
953114691 3:39980379-39980401 AAAACTGCCTTTGGCCTTATGGG - Intronic
956281762 3:67564775-67564797 TTGGCTTCCTTGGGCCATAGTGG - Intronic
957541772 3:81580383-81580405 AAGCCTTCCTTGGGTCATGTAGG - Intronic
958753767 3:98225582-98225604 TTAGCTTCCATGGGCCATATTGG + Intergenic
958997492 3:100921700-100921722 AAACCTTCCTTTTGCCATTTTGG - Intronic
961330917 3:126137419-126137441 AAATCTTCCTTGAGCTATCTTGG - Intronic
962712435 3:138099384-138099406 TTGGCTTCCTTGGGCCACATTGG - Intronic
963615019 3:147525765-147525787 TTGGCTTCCCTGGGCCATATTGG + Intergenic
963967706 3:151391506-151391528 TTGGCTTCCTTGGGCCACATTGG + Intronic
964415973 3:156448113-156448135 AAATATTCCTTGGTCCATAAAGG + Intronic
966768710 3:183485057-183485079 AAAGCTTCTTTGACCCATACAGG - Intergenic
967125499 3:186419793-186419815 AAAGCTTCCTAGGCAAATATGGG + Intergenic
968400752 4:294747-294769 TTGGCTTCCTTGGGCCACATTGG - Intronic
969259917 4:6026788-6026810 AAAGCTGCCGTGGGCCACATGGG - Intronic
970474687 4:16410298-16410320 AAAGCATCCTTTGGCCATTTTGG - Intergenic
970615329 4:17763491-17763513 TAGGCTTCCTTGGGACAAATAGG + Intronic
971573178 4:28239718-28239740 AAGCCTTCCTTCGGCCATCTGGG - Intergenic
971592446 4:28485259-28485281 GAAACTTCCTTTGGCCATCTTGG + Intergenic
973028113 4:45299704-45299726 ACGGCTTCCCTGGGCCACATTGG + Intergenic
973173420 4:47174265-47174287 TAAGCCACCTTGGGCAATATAGG - Intronic
975018849 4:69462121-69462143 AAAGCTTCCTTGGAAAATGTGGG - Intergenic
975858640 4:78652048-78652070 AAGGCTTCCCTGGGCCACATTGG - Intergenic
977220123 4:94328049-94328071 AGAGCCCCCTTGGGCCTTATGGG - Intronic
978872566 4:113597578-113597600 AAAGCTTTATTGGTCCATATAGG - Intronic
979491975 4:121338585-121338607 TTCGCTTCCCTGGGCCATATTGG - Intronic
980278384 4:130684989-130685011 AAAGCAACCTTGGGTCATGTAGG + Intergenic
980600313 4:135015973-135015995 AAGGCTTCATGGGACCATATGGG - Intergenic
982796325 4:159649756-159649778 AAAGGGTCCCTGGGCCATGTTGG + Intergenic
983515204 4:168648422-168648444 AAAGCTTTTTCGGTCCATATGGG + Intronic
985417146 4:189747490-189747512 TAATCTTGCTTTGGCCATATGGG - Intergenic
989001387 5:36764151-36764173 GAAGCTTCCTTGTTTCATATGGG - Intergenic
989070125 5:37501420-37501442 TTGGCTTCCTTGGGCCACATTGG + Intronic
992712482 5:79473398-79473420 TTGGCTTCCCTGGGCCATATTGG - Intronic
994281665 5:97911236-97911258 TTGGCTTCCTTGGGCCACATTGG + Intergenic
994665434 5:102699071-102699093 AAACCTTCCTTTCCCCATATTGG - Intergenic
995686835 5:114780980-114781002 AAACCTTCCTTGGGGGATATAGG + Intergenic
995971185 5:117973481-117973503 AAAGCTTCCCAAGGCCATAGGGG - Intergenic
996650211 5:125866645-125866667 TTGGCTTCCTTGGGCCACATTGG - Intergenic
999040539 5:148405402-148405424 AAAATTGCCTTGGGCCACATTGG - Intronic
999097304 5:148991423-148991445 AAAGCTAACTTTAGCCATATGGG + Intronic
1000936924 5:167313291-167313313 TTGGCTTCCTTGGGCCATATTGG + Intronic
1000964087 5:167634228-167634250 CATGCTTCCTGGGGCTATATTGG - Intronic
1001253349 5:170165344-170165366 CAAGTTTTCTTGTGCCATATTGG + Intergenic
1002168296 5:177361473-177361495 CAAGCTTCCTTGGTCCACAAAGG + Intronic
1003065374 6:2900435-2900457 CAAGCTTACCTGGGCCATCTGGG + Exonic
1005647793 6:27857787-27857809 AAATCTTGCTTTTGCCATATTGG - Intronic
1005718993 6:28582328-28582350 TTGGCTTCCCTGGGCCATATTGG - Intronic
1007737342 6:43989987-43990009 TCAGCTTCCTTGGGGAATATGGG - Intergenic
1007844667 6:44743236-44743258 AAAGCTTTCCTGGGACATTTGGG + Intergenic
1011942741 6:92863107-92863129 AAAGGTTCCTTGGCCCACACCGG + Intergenic
1012250633 6:96976318-96976340 AATGCTTCCTGGGGCCCCATTGG + Intronic
1012702423 6:102477293-102477315 ATAGCTTCCCTGGGCCACATTGG - Intergenic
1013603647 6:111728059-111728081 AAAGCCTCATTTGGCCATTTAGG - Intronic
1013613371 6:111817603-111817625 AGAGCATCCTTGGGCCATGAGGG - Intronic
1014880029 6:126712202-126712224 AAGGCTGCTTTGGGCCATCTTGG - Intergenic
1014930123 6:127325763-127325785 AAGGCTTCATTGAGCCATGTTGG - Intronic
1015040836 6:128716842-128716864 AAAGCTTCGTTTTTCCATATTGG + Intergenic
1016133883 6:140513451-140513473 TTGGCTTCCTTGGGCCATATTGG - Intergenic
1016359315 6:143250894-143250916 TTGGCTTCCTTGGGCCACATTGG - Intronic
1017502099 6:155035035-155035057 AAAGCTTCGTGGACCCATATAGG - Intronic
1021390813 7:20090357-20090379 AAAGCTTACTTTGGCCAGATAGG - Intergenic
1022314097 7:29228686-29228708 AAAACCTCATTGGGCAATATTGG + Intronic
1026990421 7:74582030-74582052 AAAGCTTGGCTGGGCCATCTGGG + Intronic
1031519522 7:122746533-122746555 TTGGCTTCCCTGGGCCATATTGG + Intronic
1031686765 7:124739844-124739866 TTAGCTTCCCTGGGCCACATTGG + Intergenic
1032019471 7:128398996-128399018 AATGCTTCCCTGGTCCATACTGG - Intronic
1032831143 7:135627657-135627679 AAAGCTTCCTTGGGCCATATAGG - Intronic
1035331970 7:158102309-158102331 AAAGCATCCTCGGGCCAGCTCGG - Intronic
1038836045 8:31124945-31124967 AAAGCCTCCTTGGGAATTATGGG + Exonic
1039235197 8:35495368-35495390 TTAGCTTCCCTGGGCCACATTGG + Intronic
1039759743 8:40561851-40561873 TTAGCTTCCCTGGGCCATATTGG - Intronic
1040582822 8:48711264-48711286 AATGCTTCTTTGGGCCGTCTCGG - Intronic
1041855866 8:62454220-62454242 TCAGCTTCCATGGGCCACATTGG + Intronic
1043610336 8:82054965-82054987 TTGGCCTCCTTGGGCCATATTGG - Intergenic
1046143210 8:110121540-110121562 GAAGCTTCCCTGGGCCAGAGAGG + Intergenic
1046604812 8:116359652-116359674 AAATCTTCCTTGAGCCGTACTGG + Intergenic
1048630743 8:136239622-136239644 AATCCTTCCTTGATCCATATTGG + Intergenic
1055299168 9:74865152-74865174 AAATCTTCCTGGAGCCAAATAGG + Intronic
1057178975 9:93019598-93019620 AATGCCTCCTTGGACCATAATGG - Intronic
1058509545 9:105702179-105702201 AAAGCATACTTGAGGCATATAGG + Intronic
1058797599 9:108513588-108513610 TTGGCTTCCTTGGGCCACATTGG - Intergenic
1059189240 9:112308024-112308046 AGGGCTTCCCTGGGCCATACTGG - Intronic
1060571654 9:124646576-124646598 TAAGCTTCCCTGGGCCACATTGG + Intronic
1060594664 9:124840871-124840893 AAAGCTCCATTTGGCCATTTGGG + Intergenic
1187993059 X:24896577-24896599 TTAGCTTCCCTGAGCCATATTGG - Intronic
1189332194 X:40151176-40151198 AAAGCATCCTTGTGGCATGTGGG + Intronic
1190063186 X:47223784-47223806 GAAGCAGCCTGGGGCCATATGGG - Intronic
1190077459 X:47328314-47328336 CATGCTTCCTGTGGCCATATTGG + Intergenic
1190251665 X:48731594-48731616 CAGGCTTCCCTGGGCCACATTGG - Intergenic
1191059298 X:56277977-56277999 AAAGAGGCCTTGGGCCTTATGGG - Intronic
1193585109 X:83311585-83311607 AAAGAGTCCTTGGGCCTTAATGG + Intergenic
1197517138 X:127446992-127447014 TTAGCTTCCCTGGGCCACATTGG - Intergenic
1198646788 X:138816838-138816860 TTGGCTTCCCTGGGCCATATTGG - Intronic