ID: 1032832122

View in Genome Browser
Species Human (GRCh38)
Location 7:135638657-135638679
Sequence CAGTTAATAGAGATGGACCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 64}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032832117_1032832122 22 Left 1032832117 7:135638612-135638634 CCTTCCAGCATGCTGTGTGTCTC 0: 1
1: 0
2: 1
3: 31
4: 222
Right 1032832122 7:135638657-135638679 CAGTTAATAGAGATGGACCGCGG 0: 1
1: 0
2: 0
3: 5
4: 64
1032832114_1032832122 28 Left 1032832114 7:135638606-135638628 CCCCTACCTTCCAGCATGCTGTG 0: 1
1: 0
2: 1
3: 20
4: 506
Right 1032832122 7:135638657-135638679 CAGTTAATAGAGATGGACCGCGG 0: 1
1: 0
2: 0
3: 5
4: 64
1032832115_1032832122 27 Left 1032832115 7:135638607-135638629 CCCTACCTTCCAGCATGCTGTGT 0: 1
1: 0
2: 0
3: 20
4: 214
Right 1032832122 7:135638657-135638679 CAGTTAATAGAGATGGACCGCGG 0: 1
1: 0
2: 0
3: 5
4: 64
1032832118_1032832122 18 Left 1032832118 7:135638616-135638638 CCAGCATGCTGTGTGTCTCTTCA 0: 1
1: 0
2: 0
3: 24
4: 240
Right 1032832122 7:135638657-135638679 CAGTTAATAGAGATGGACCGCGG 0: 1
1: 0
2: 0
3: 5
4: 64
1032832119_1032832122 -7 Left 1032832119 7:135638641-135638663 CCTAGCCTTTCAGAAACAGTTAA 0: 1
1: 0
2: 2
3: 19
4: 236
Right 1032832122 7:135638657-135638679 CAGTTAATAGAGATGGACCGCGG 0: 1
1: 0
2: 0
3: 5
4: 64
1032832116_1032832122 26 Left 1032832116 7:135638608-135638630 CCTACCTTCCAGCATGCTGTGTG 0: 1
1: 0
2: 2
3: 27
4: 259
Right 1032832122 7:135638657-135638679 CAGTTAATAGAGATGGACCGCGG 0: 1
1: 0
2: 0
3: 5
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032832122 Original CRISPR CAGTTAATAGAGATGGACCG CGG Exonic
910224343 1:84921068-84921090 CAGTTACTAGAGATCAACCGTGG + Intergenic
915105378 1:153532297-153532319 CAGTTTACAGAGATGGTCTGTGG + Intergenic
915154262 1:153861391-153861413 AAATAAATAGAGATGGCCCGGGG - Intronic
921429388 1:215046245-215046267 CATTTAATAGAGATGGCCCTTGG + Intronic
923008294 1:230068504-230068526 GAGTTAATGGAGATGGACTACGG + Intronic
1072814609 10:98492911-98492933 CAAGTTATAGAGATGGACAGTGG - Intronic
1073112684 10:101072018-101072040 CAGATAAAAGAGATGGATGGAGG - Intergenic
1074032764 10:109705016-109705038 CAGGTGCTAGAGATGGACAGAGG + Intergenic
1076630687 10:131850224-131850246 AAGTTAATGCAGATGGACCTCGG + Intergenic
1076933014 10:133546341-133546363 CAGTGAGGAGAGATGGACCTGGG - Intronic
1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG + Intronic
1087943390 11:104128378-104128400 CATTTAGTAGAGATGAACCAAGG - Intronic
1090460247 11:126885033-126885055 AAGTTAATAGAGAAGGCCCTTGG + Intronic
1093893748 12:24553937-24553959 CGGTTAATAGAGAAGGTACGTGG + Intergenic
1093925511 12:24904497-24904519 CAGTTAATACAGATGGAGGCCGG - Intronic
1097210674 12:57366528-57366550 CAGTCAATAGAAATAGACCCAGG - Intronic
1098576150 12:72044975-72044997 CAGTTAATTGAGTTTGACAGAGG - Intronic
1102566192 12:113798950-113798972 CACTTTATAGAGACGGAACGAGG + Intergenic
1111951517 13:94712414-94712436 CATTTAAGAGAGAACGACCGAGG - Intergenic
1111970131 13:94903604-94903626 CAGTTATTAGAAATGTACTGGGG - Intergenic
1113717957 13:112527440-112527462 CAGTTAAAACAGATCGACTGTGG - Exonic
1119620495 14:76128215-76128237 CATTTAATAGAGGGGGACCCAGG + Intergenic
1122080257 14:99262225-99262247 CAGTTGTTAGAGATGGGCCAGGG - Intronic
1140024951 16:71278951-71278973 CAGTTAATACAGAAGGAACCTGG + Intergenic
1144036060 17:11367109-11367131 CATTTCATAGAGAAGGACAGTGG + Intronic
1154279888 18:12993209-12993231 CAGTTAATAGGGATGGATTTGGG + Intronic
1156846858 18:41675820-41675842 CTGTTAATAGTGATGGAACGTGG - Intergenic
1163842728 19:19621193-19621215 CATTTAATATAGAAGGACCTGGG + Intergenic
1164678489 19:30118797-30118819 CAGTGAATAGGGAGGGACCCTGG - Intergenic
1168692862 19:58387238-58387260 CAGTTAAAAGTGTTGGCCCGCGG + Intronic
926091020 2:10049623-10049645 CAGTAAGTAGAGATGGGCAGAGG - Intronic
927047667 2:19296269-19296291 AATTTATGAGAGATGGACCGAGG + Intergenic
937941780 2:127291725-127291747 CATTTAAAAGAGATGGACAGTGG - Intronic
939865806 2:147471186-147471208 CAGTTAACAGAGATTGATCAGGG + Intergenic
941511958 2:166422608-166422630 CAGTAAATAGACCTGGACAGGGG + Intronic
942881036 2:180860581-180860603 CAGGTAATTGAAATGGACGGTGG - Intergenic
943529421 2:189060497-189060519 CAGTTAATAGATTTGAACCCAGG - Intronic
943991194 2:194694839-194694861 CAGTGAATAGAAATGGACTCAGG + Intergenic
947622611 2:231600452-231600474 CAGTTAATAGAGACAGAAGGAGG + Intergenic
949637091 3:5994944-5994966 CAGTTACTTGAGTTGGACTGCGG - Intergenic
949849038 3:8403273-8403295 CAGTCAATAGAAATGGACTCTGG + Intergenic
954153078 3:48668538-48668560 CAGTTAATAGAGTTGCTCCTGGG - Intergenic
957265253 3:77955421-77955443 TAGTTAATTGAGATGTAACGTGG + Intergenic
970173275 4:13310234-13310256 CATTTAAAAGAGAAGGACAGTGG + Intergenic
970499342 4:16661431-16661453 CACTTACTAGATATGGACCTTGG + Intronic
976558299 4:86475102-86475124 CAGTGAAGAGAGATGGAGTGGGG - Intronic
985173883 4:187180325-187180347 TATTTAATAGAGATGGAACTAGG - Intergenic
989371366 5:40712086-40712108 AAGTTAATAGAGGTGAACAGAGG + Intergenic
991203244 5:64018879-64018901 GAATTAATAGAGATGGCTCGTGG - Intergenic
992707877 5:79415871-79415893 CATTTAATAGATATGGGCCTTGG + Intronic
1000980656 5:167813202-167813224 CAGTTAGTAGAGATGGGATGAGG + Intronic
1001098628 5:168795939-168795961 GAGTAAAAAGAGATGGACCATGG + Intronic
1002113236 5:176935804-176935826 GAGTTAACAGAGAAGGACCAAGG - Intronic
1002400242 5:178987608-178987630 CAATTCATAGAGAGGGGCCGTGG + Intronic
1011579266 6:88841072-88841094 CAGTTAATAGACTTCCACCGTGG + Intronic
1013931978 6:115545391-115545413 CAGTGAAGAGAGATGGGCCAGGG - Intergenic
1019872370 7:3776795-3776817 CATTTAACAGAGATTGACCTTGG + Intronic
1021907376 7:25348784-25348806 CAGATAATAGAGGTGAACAGAGG - Intergenic
1024990548 7:55231807-55231829 CAGTAAGGAGGGATGGACCGGGG + Intronic
1028579674 7:92395164-92395186 CAGGTAATAGCGATGGTCCCAGG + Intronic
1030777525 7:113552684-113552706 CATTTAATAGTTTTGGACCGTGG - Intergenic
1032832122 7:135638657-135638679 CAGTTAATAGAGATGGACCGCGG + Exonic
1048946671 8:139455192-139455214 AACTTAATAGAGATGGACCTGGG + Intergenic
1051728760 9:20116015-20116037 CAGTTCATAGAAATGGACAATGG - Intergenic
1052075993 9:24141374-24141396 AAGTTAATAGAGGTCCACCGTGG - Intergenic
1052275269 9:26668201-26668223 CAGTTCATAGAAATGGAAAGTGG - Intergenic
1056362186 9:85869677-85869699 CAGTTAAAATACATGGACCTCGG - Intergenic
1060960291 9:127676029-127676051 CATTTAAAAGACATGGACTGGGG + Intronic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1189684957 X:43554329-43554351 CAGTTTGTAGAAATGGACAGAGG - Intergenic