ID: 1032841173

View in Genome Browser
Species Human (GRCh38)
Location 7:135714601-135714623
Sequence ATGCGGGCCCGTGGGCATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032841173_1032841182 7 Left 1032841173 7:135714601-135714623 CCCACATGCCCACGGGCCCGCAT No data
Right 1032841182 7:135714631-135714653 ACCGGTCAGCCTCCATGGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 49
1032841173_1032841186 16 Left 1032841173 7:135714601-135714623 CCCACATGCCCACGGGCCCGCAT No data
Right 1032841186 7:135714640-135714662 CCTCCATGGCGAGGAGAGATGGG 0: 1
1: 0
2: 0
3: 14
4: 141
1032841173_1032841184 15 Left 1032841173 7:135714601-135714623 CCCACATGCCCACGGGCCCGCAT No data
Right 1032841184 7:135714639-135714661 GCCTCCATGGCGAGGAGAGATGG No data
1032841173_1032841188 21 Left 1032841173 7:135714601-135714623 CCCACATGCCCACGGGCCCGCAT No data
Right 1032841188 7:135714645-135714667 ATGGCGAGGAGAGATGGGAAAGG 0: 1
1: 0
2: 6
3: 74
4: 541
1032841173_1032841181 2 Left 1032841173 7:135714601-135714623 CCCACATGCCCACGGGCCCGCAT No data
Right 1032841181 7:135714626-135714648 AGAGGACCGGTCAGCCTCCATGG 0: 1
1: 0
2: 0
3: 7
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032841173 Original CRISPR ATGCGGGCCCGTGGGCATGT GGG (reversed) Intronic