ID: 1032841174

View in Genome Browser
Species Human (GRCh38)
Location 7:135714602-135714624
Sequence CATGCGGGCCCGTGGGCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 109}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032841174_1032841186 15 Left 1032841174 7:135714602-135714624 CCACATGCCCACGGGCCCGCATG 0: 1
1: 1
2: 1
3: 8
4: 109
Right 1032841186 7:135714640-135714662 CCTCCATGGCGAGGAGAGATGGG 0: 1
1: 0
2: 0
3: 14
4: 141
1032841174_1032841182 6 Left 1032841174 7:135714602-135714624 CCACATGCCCACGGGCCCGCATG 0: 1
1: 1
2: 1
3: 8
4: 109
Right 1032841182 7:135714631-135714653 ACCGGTCAGCCTCCATGGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 49
1032841174_1032841188 20 Left 1032841174 7:135714602-135714624 CCACATGCCCACGGGCCCGCATG 0: 1
1: 1
2: 1
3: 8
4: 109
Right 1032841188 7:135714645-135714667 ATGGCGAGGAGAGATGGGAAAGG 0: 1
1: 0
2: 6
3: 74
4: 541
1032841174_1032841181 1 Left 1032841174 7:135714602-135714624 CCACATGCCCACGGGCCCGCATG 0: 1
1: 1
2: 1
3: 8
4: 109
Right 1032841181 7:135714626-135714648 AGAGGACCGGTCAGCCTCCATGG 0: 1
1: 0
2: 0
3: 7
4: 123
1032841174_1032841184 14 Left 1032841174 7:135714602-135714624 CCACATGCCCACGGGCCCGCATG 0: 1
1: 1
2: 1
3: 8
4: 109
Right 1032841184 7:135714639-135714661 GCCTCCATGGCGAGGAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032841174 Original CRISPR CATGCGGGCCCGTGGGCATG TGG (reversed) Intronic