ID: 1032841180

View in Genome Browser
Species Human (GRCh38)
Location 7:135714618-135714640
Sequence GCTGACCGGTCCTCTGCATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032841180_1032841188 4 Left 1032841180 7:135714618-135714640 CCGCATGCAGAGGACCGGTCAGC No data
Right 1032841188 7:135714645-135714667 ATGGCGAGGAGAGATGGGAAAGG 0: 1
1: 0
2: 6
3: 74
4: 541
1032841180_1032841182 -10 Left 1032841180 7:135714618-135714640 CCGCATGCAGAGGACCGGTCAGC No data
Right 1032841182 7:135714631-135714653 ACCGGTCAGCCTCCATGGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 49
1032841180_1032841186 -1 Left 1032841180 7:135714618-135714640 CCGCATGCAGAGGACCGGTCAGC No data
Right 1032841186 7:135714640-135714662 CCTCCATGGCGAGGAGAGATGGG 0: 1
1: 0
2: 0
3: 14
4: 141
1032841180_1032841184 -2 Left 1032841180 7:135714618-135714640 CCGCATGCAGAGGACCGGTCAGC No data
Right 1032841184 7:135714639-135714661 GCCTCCATGGCGAGGAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032841180 Original CRISPR GCTGACCGGTCCTCTGCATG CGG (reversed) Intronic