ID: 1032841181

View in Genome Browser
Species Human (GRCh38)
Location 7:135714626-135714648
Sequence AGAGGACCGGTCAGCCTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 123}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032841177_1032841181 -7 Left 1032841177 7:135714610-135714632 CCACGGGCCCGCATGCAGAGGAC 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1032841181 7:135714626-135714648 AGAGGACCGGTCAGCCTCCATGG 0: 1
1: 0
2: 0
3: 7
4: 123
1032841172_1032841181 6 Left 1032841172 7:135714597-135714619 CCAGCCCACATGCCCACGGGCCC No data
Right 1032841181 7:135714626-135714648 AGAGGACCGGTCAGCCTCCATGG 0: 1
1: 0
2: 0
3: 7
4: 123
1032841173_1032841181 2 Left 1032841173 7:135714601-135714623 CCCACATGCCCACGGGCCCGCAT No data
Right 1032841181 7:135714626-135714648 AGAGGACCGGTCAGCCTCCATGG 0: 1
1: 0
2: 0
3: 7
4: 123
1032841169_1032841181 18 Left 1032841169 7:135714585-135714607 CCAGCTGGATGTCCAGCCCACAT 0: 1
1: 0
2: 1
3: 14
4: 158
Right 1032841181 7:135714626-135714648 AGAGGACCGGTCAGCCTCCATGG 0: 1
1: 0
2: 0
3: 7
4: 123
1032841176_1032841181 -6 Left 1032841176 7:135714609-135714631 CCCACGGGCCCGCATGCAGAGGA 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1032841181 7:135714626-135714648 AGAGGACCGGTCAGCCTCCATGG 0: 1
1: 0
2: 0
3: 7
4: 123
1032841174_1032841181 1 Left 1032841174 7:135714602-135714624 CCACATGCCCACGGGCCCGCATG 0: 1
1: 1
2: 1
3: 8
4: 109
Right 1032841181 7:135714626-135714648 AGAGGACCGGTCAGCCTCCATGG 0: 1
1: 0
2: 0
3: 7
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032841181 Original CRISPR AGAGGACCGGTCAGCCTCCA TGG Intronic