ID: 1032841186

View in Genome Browser
Species Human (GRCh38)
Location 7:135714640-135714662
Sequence CCTCCATGGCGAGGAGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 141}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032841180_1032841186 -1 Left 1032841180 7:135714618-135714640 CCGCATGCAGAGGACCGGTCAGC No data
Right 1032841186 7:135714640-135714662 CCTCCATGGCGAGGAGAGATGGG 0: 1
1: 0
2: 0
3: 14
4: 141
1032841172_1032841186 20 Left 1032841172 7:135714597-135714619 CCAGCCCACATGCCCACGGGCCC No data
Right 1032841186 7:135714640-135714662 CCTCCATGGCGAGGAGAGATGGG 0: 1
1: 0
2: 0
3: 14
4: 141
1032841174_1032841186 15 Left 1032841174 7:135714602-135714624 CCACATGCCCACGGGCCCGCATG 0: 1
1: 1
2: 1
3: 8
4: 109
Right 1032841186 7:135714640-135714662 CCTCCATGGCGAGGAGAGATGGG 0: 1
1: 0
2: 0
3: 14
4: 141
1032841179_1032841186 0 Left 1032841179 7:135714617-135714639 CCCGCATGCAGAGGACCGGTCAG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1032841186 7:135714640-135714662 CCTCCATGGCGAGGAGAGATGGG 0: 1
1: 0
2: 0
3: 14
4: 141
1032841173_1032841186 16 Left 1032841173 7:135714601-135714623 CCCACATGCCCACGGGCCCGCAT No data
Right 1032841186 7:135714640-135714662 CCTCCATGGCGAGGAGAGATGGG 0: 1
1: 0
2: 0
3: 14
4: 141
1032841176_1032841186 8 Left 1032841176 7:135714609-135714631 CCCACGGGCCCGCATGCAGAGGA 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1032841186 7:135714640-135714662 CCTCCATGGCGAGGAGAGATGGG 0: 1
1: 0
2: 0
3: 14
4: 141
1032841177_1032841186 7 Left 1032841177 7:135714610-135714632 CCACGGGCCCGCATGCAGAGGAC 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1032841186 7:135714640-135714662 CCTCCATGGCGAGGAGAGATGGG 0: 1
1: 0
2: 0
3: 14
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032841186 Original CRISPR CCTCCATGGCGAGGAGAGAT GGG Intronic