ID: 1032841188

View in Genome Browser
Species Human (GRCh38)
Location 7:135714645-135714667
Sequence ATGGCGAGGAGAGATGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 622
Summary {0: 1, 1: 0, 2: 6, 3: 74, 4: 541}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032841173_1032841188 21 Left 1032841173 7:135714601-135714623 CCCACATGCCCACGGGCCCGCAT No data
Right 1032841188 7:135714645-135714667 ATGGCGAGGAGAGATGGGAAAGG 0: 1
1: 0
2: 6
3: 74
4: 541
1032841180_1032841188 4 Left 1032841180 7:135714618-135714640 CCGCATGCAGAGGACCGGTCAGC No data
Right 1032841188 7:135714645-135714667 ATGGCGAGGAGAGATGGGAAAGG 0: 1
1: 0
2: 6
3: 74
4: 541
1032841176_1032841188 13 Left 1032841176 7:135714609-135714631 CCCACGGGCCCGCATGCAGAGGA 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1032841188 7:135714645-135714667 ATGGCGAGGAGAGATGGGAAAGG 0: 1
1: 0
2: 6
3: 74
4: 541
1032841179_1032841188 5 Left 1032841179 7:135714617-135714639 CCCGCATGCAGAGGACCGGTCAG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1032841188 7:135714645-135714667 ATGGCGAGGAGAGATGGGAAAGG 0: 1
1: 0
2: 6
3: 74
4: 541
1032841172_1032841188 25 Left 1032841172 7:135714597-135714619 CCAGCCCACATGCCCACGGGCCC No data
Right 1032841188 7:135714645-135714667 ATGGCGAGGAGAGATGGGAAAGG 0: 1
1: 0
2: 6
3: 74
4: 541
1032841183_1032841188 -10 Left 1032841183 7:135714632-135714654 CCGGTCAGCCTCCATGGCGAGGA 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1032841188 7:135714645-135714667 ATGGCGAGGAGAGATGGGAAAGG 0: 1
1: 0
2: 6
3: 74
4: 541
1032841174_1032841188 20 Left 1032841174 7:135714602-135714624 CCACATGCCCACGGGCCCGCATG 0: 1
1: 1
2: 1
3: 8
4: 109
Right 1032841188 7:135714645-135714667 ATGGCGAGGAGAGATGGGAAAGG 0: 1
1: 0
2: 6
3: 74
4: 541
1032841177_1032841188 12 Left 1032841177 7:135714610-135714632 CCACGGGCCCGCATGCAGAGGAC 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1032841188 7:135714645-135714667 ATGGCGAGGAGAGATGGGAAAGG 0: 1
1: 0
2: 6
3: 74
4: 541

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032841188 Original CRISPR ATGGCGAGGAGAGATGGGAA AGG Intronic