ID: 1032845086

View in Genome Browser
Species Human (GRCh38)
Location 7:135745417-135745439
Sequence CTGCCAGGGCACCACTGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 194}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032845086_1032845094 -5 Left 1032845086 7:135745417-135745439 CCCTTCCAGTGGTGCCCTGGCAG 0: 1
1: 0
2: 2
3: 16
4: 194
Right 1032845094 7:135745435-135745457 GGCAGGACCTGGTATGTGCTGGG 0: 1
1: 0
2: 2
3: 30
4: 275
1032845086_1032845095 1 Left 1032845086 7:135745417-135745439 CCCTTCCAGTGGTGCCCTGGCAG 0: 1
1: 0
2: 2
3: 16
4: 194
Right 1032845095 7:135745441-135745463 ACCTGGTATGTGCTGGGACGTGG 0: 1
1: 0
2: 2
3: 17
4: 158
1032845086_1032845097 2 Left 1032845086 7:135745417-135745439 CCCTTCCAGTGGTGCCCTGGCAG 0: 1
1: 0
2: 2
3: 16
4: 194
Right 1032845097 7:135745442-135745464 CCTGGTATGTGCTGGGACGTGGG No data
1032845086_1032845093 -6 Left 1032845086 7:135745417-135745439 CCCTTCCAGTGGTGCCCTGGCAG 0: 1
1: 0
2: 2
3: 16
4: 194
Right 1032845093 7:135745434-135745456 TGGCAGGACCTGGTATGTGCTGG 0: 1
1: 1
2: 1
3: 13
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032845086 Original CRISPR CTGCCAGGGCACCACTGGAA GGG (reversed) Intronic
900081827 1:864254-864276 TAGCCAGGGCACCACAGAAAGGG + Intergenic
902743008 1:18453235-18453257 CTGCGAGGGTACAAATGGAAAGG + Intergenic
903027988 1:20443167-20443189 TTGCCATGGCAGCCCTGGAATGG + Intergenic
907132066 1:52105786-52105808 CTGCCTGGGCAACACAGCAAGGG - Intergenic
907675258 1:56512011-56512033 CTGCCAGAACATCACTGGGATGG + Exonic
908253067 1:62280420-62280442 CTGCCAGGGATGCACTGAAAAGG + Intronic
911164971 1:94716490-94716512 CAGCCAAGGGACCACTGCAAAGG - Intergenic
913264714 1:117033259-117033281 CAGCCAGAGCAACACAGGAAAGG + Intronic
915039115 1:152952946-152952968 GTGCCAGGGCATGACAGGAAGGG + Intergenic
916665105 1:166959445-166959467 TTGCTGGGTCACCACTGGAAGGG - Intronic
916880137 1:169012819-169012841 CTGCCAGAACCCCACAGGAATGG - Intergenic
919239090 1:194888790-194888812 CTTCCAGGGCGCCAATTGAAAGG - Intergenic
920276197 1:204806934-204806956 GCTCCAGGACACCACTGGAAGGG + Intergenic
921935094 1:220788332-220788354 CTGCGAGGGCTGCTCTGGAAAGG - Intronic
1064228287 10:13506502-13506524 CTGCTAGGGCACCACATGCAGGG + Intronic
1065720789 10:28627072-28627094 CTGCCAAGGCATCAGTGGAAAGG - Intergenic
1070397526 10:76024639-76024661 CGGGCAGGGCCCCCCTGGAATGG - Intronic
1072098297 10:92204502-92204524 CTCCCTGGCCATCACTGGAAAGG + Intronic
1072633552 10:97163541-97163563 CTGCCAGGGCAGCATTAGCAAGG + Intronic
1072896051 10:99367841-99367863 CTGCCCAGACACCACTTGAAGGG + Intronic
1073294840 10:102432622-102432644 CCGCCACGGCGCCTCTGGAAGGG - Exonic
1074579895 10:114708939-114708961 CTTCCAGGTCAGCATTGGAATGG + Intergenic
1075417477 10:122275649-122275671 CACCCAGGGCACCAATGGAGAGG - Intronic
1075812215 10:125232512-125232534 CTGGCCAGCCACCACTGGAATGG - Intergenic
1076235905 10:128863768-128863790 CTGCCATGCCACCACTGGGGTGG - Intergenic
1076245845 10:128946942-128946964 CTGGCAGGGCAGCCCTGGGAGGG - Intergenic
1076725463 10:132410915-132410937 CTGCCAGGGCAGGAGGGGAAAGG - Intronic
1077000819 11:321347-321369 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077000876 11:321620-321642 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077000894 11:321698-321720 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077000921 11:321815-321837 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077000938 11:321893-321915 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077000973 11:322049-322071 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077001000 11:322166-322188 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077001017 11:322244-322266 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077001044 11:322361-322383 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077001061 11:322439-322461 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077001079 11:322517-322539 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077320123 11:1937300-1937322 CAGCCAGGGGACCCCTAGAAGGG + Intronic
1078579119 11:12525286-12525308 CTTCCAGGGCACCACTGTCATGG - Intronic
1078946206 11:16071155-16071177 CTGCCTGGCTACCAGTGGAAGGG - Intronic
1079355552 11:19727470-19727492 TTCCCAGGGCACCAGTGGGAGGG + Intronic
1079377791 11:19909310-19909332 CTGCCTGGGTACTCCTGGAATGG - Intronic
1080897009 11:36455564-36455586 CTAAAAGGGCACCACTGCAAGGG + Intronic
1081590425 11:44419107-44419129 CTGACAGGGAGACACTGGAAAGG + Intergenic
1082994685 11:59243532-59243554 CTTCCAGGGTACCAATTGAAAGG + Intergenic
1084282576 11:68108052-68108074 CTGACGGGGCTCCACTGGAGGGG + Intronic
1085309339 11:75506969-75506991 CTGCCTGGGGACCACAGGATTGG - Intronic
1086230975 11:84569252-84569274 CTGCCAAAGAACCCCTGGAAAGG + Intronic
1088065875 11:105718781-105718803 CTGCCAAGGGAGCAGTGGAATGG - Intronic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1088851702 11:113708590-113708612 CTTCCAGGGAACCACTAGACAGG - Intergenic
1089861868 11:121597096-121597118 CAGACAGGGCACCTCTGAAAAGG - Intronic
1090174554 11:124637016-124637038 CTGGCAGGGCACTACTGGGGTGG + Exonic
1090254576 11:125274446-125274468 CTGGCAGGGCACCTCTGCACAGG - Intronic
1091334130 11:134753950-134753972 CTACCAGGGGACCGCTGAAAGGG - Intergenic
1095956764 12:47811162-47811184 ATTCTAGGGCACCACTGGGATGG - Intronic
1096540575 12:52304770-52304792 ATGCCAGGTCACCCCGGGAAGGG + Intronic
1096580118 12:52579710-52579732 CTACCAGGGCAGCCCTGGAGGGG - Intergenic
1099328699 12:81253312-81253334 CTGCCACGGTACCATGGGAAAGG - Exonic
1101575601 12:105993889-105993911 CTTCCAGGGATCCACTGGGAAGG - Intergenic
1104860308 12:131919970-131919992 CAGCCTGCGCACCACTGCAAAGG - Exonic
1113880413 13:113622393-113622415 GCGTCAGGGCAACACTGGAAGGG - Intronic
1114511774 14:23268199-23268221 CTTCCAGGGAACCACTAGACAGG + Intronic
1114648340 14:24268037-24268059 CTCTCAGGGCCACACTGGAAAGG + Intronic
1115873100 14:37828072-37828094 CTGCCATGGGACCACTGGACTGG + Intronic
1118982032 14:70724863-70724885 CTGTCTGTGCACCCCTGGAATGG + Intronic
1122144317 14:99680197-99680219 CTGCCAGGCCACCCATGTAAAGG + Exonic
1122409807 14:101520085-101520107 CTGGGACGGCAGCACTGGAAGGG + Intergenic
1124055314 15:26236423-26236445 CTTCCATGGTTCCACTGGAATGG + Intergenic
1128041828 15:64581564-64581586 CTTCCAGGGAACCACCGGAAAGG + Intronic
1129609832 15:77044413-77044435 TTGCCTGGGAACCACTAGAAGGG - Exonic
1129927784 15:79381584-79381606 CAGCCTGGGCACCACTGGGCAGG - Intronic
1133483938 16:6200088-6200110 CTGCAAGGACCCCATTGGAAAGG + Intronic
1134392056 16:13829291-13829313 CTGCAAGGGTACCAGTGGAAGGG - Intergenic
1134776721 16:16859626-16859648 CCGCAAGGGAACCACTGCAAGGG - Intergenic
1135990624 16:27216582-27216604 ATCCCAGGGCCCCACTGCAAAGG - Intronic
1136271578 16:29151954-29151976 CTGCCAGGGCCGCACTGGGCAGG + Intergenic
1142075193 16:88113938-88113960 CTGCCAGGGCCGCACTGGGCAGG + Intronic
1142355745 16:89600999-89601021 CTGCCAGGACCCCACAGCAAGGG + Intergenic
1143542323 17:7576854-7576876 CTGCCAGGGCTGCACTGGCAGGG - Intronic
1144657290 17:17044853-17044875 CCTTCAGGGCACAACTGGAATGG + Intronic
1145958784 17:28873306-28873328 ATGCCAGTGGACCCCTGGAATGG - Intergenic
1146055102 17:29577046-29577068 CTCTCAGGTCACCACTGGCAGGG + Intronic
1146744780 17:35318662-35318684 CTTCCAGGGCACCAATTCAAAGG - Intergenic
1147641416 17:42003458-42003480 CTTCCAGGGCAGGACTTGAATGG - Intronic
1149481673 17:57008511-57008533 CTGCCCGGACAGCAATGGAAGGG - Intergenic
1151499896 17:74481877-74481899 GTGCCAGGGCACCCCTGGGAGGG + Intronic
1151923502 17:77175540-77175562 CTGCCCGGGCACCACAGTGAAGG - Intronic
1152757707 17:82093893-82093915 CTTCCAGGGTCCCACTGGGATGG - Intronic
1152791646 17:82283324-82283346 GTGTCAGGGCAAAACTGGAAGGG + Intergenic
1154230135 18:12549045-12549067 GTGCCAGGGAAGCACTGAAATGG - Intronic
1160434693 18:78838356-78838378 CCACCAGGGCCCCACTGGGAGGG - Intergenic
1160615030 18:80119837-80119859 CTGCCAGTGCAGGACAGGAATGG + Intronic
1162398189 19:10430176-10430198 CTCTCAGAGCACCACTGGCAGGG + Intronic
1163272105 19:16260550-16260572 CTGCCAGGGAGGCACTGGACTGG + Intergenic
1164418658 19:28067586-28067608 CTGCCATGGAGCCACTGGATGGG - Intergenic
1164619533 19:29686372-29686394 CAGACATGGCATCACTGGAAAGG + Intergenic
1165116194 19:33530329-33530351 CTGCCTGGCCACACCTGGAAAGG - Intergenic
1166949479 19:46416887-46416909 CTGCGAGGTCACCACTTGGAAGG - Intergenic
1167496271 19:49820450-49820472 CTGCCTGGGCACCACAGTGAAGG - Intronic
1168559918 19:57374034-57374056 CTGCTAGGGCACTGCAGGAAGGG - Intronic
925061995 2:898486-898508 CTGTCATGGCACCAGTGGAGGGG + Intergenic
927311221 2:21633767-21633789 CTGCAAGGACACCACTGTAGGGG + Intergenic
930136060 2:47905436-47905458 CTTCCCGGGCACCGCGGGAAGGG - Intronic
935080039 2:99783815-99783837 ATGACAGGGCCCCCCTGGAAAGG + Intronic
935736146 2:106107959-106107981 CTGCCTGGGCTGCAGTGGAAAGG + Intronic
937456018 2:122042376-122042398 TTGCCAGGGCAACACTCGAGCGG + Intergenic
939368434 2:141265379-141265401 CTTCCAGGGCAGCAGTTGAAGGG - Intronic
939575794 2:143893203-143893225 CTGACAGGGCAATACTGGACAGG + Intergenic
940419402 2:153461706-153461728 CTGCCAAGGCTCCACAGGGAAGG + Intergenic
942395791 2:175548122-175548144 CTTCCAGGGAACCACAAGAAAGG + Intergenic
942419623 2:175794755-175794777 GTGGCAGGACCCCACTGGAATGG + Intergenic
943703720 2:191013794-191013816 CTGCCAGAGCACGACTGGCAAGG + Intronic
948223642 2:236292176-236292198 TTGCCAAATCACCACTGGAAGGG + Intergenic
948294992 2:236853989-236854011 CTGGGAGGCCACCAGTGGAACGG - Intergenic
949047050 2:241877033-241877055 CTGCCAGGCCACCTCTGGCTGGG + Intergenic
1170978618 20:21189892-21189914 CTTCCAGGGGGCCACTTGAAGGG - Intronic
1172034629 20:32002289-32002311 CTGCAAGGGCACCCCTGGCCAGG + Exonic
1175061147 20:56244398-56244420 CTGCCAGGGTGCCACTTTAAGGG - Intergenic
1175152820 20:56948493-56948515 TTGCCAGGGCTGCACAGGAAAGG + Intergenic
1175567495 20:59991952-59991974 CTGCCAGGGCTCTGCTGCAAAGG + Intronic
1175961692 20:62640545-62640567 CTGCATAGGCACCATTGGAAAGG - Intergenic
1175991007 20:62789120-62789142 CTCCCAGGGGGCCACGGGAAGGG + Intergenic
1176030241 20:63008119-63008141 CTGGCAGGGAACCACCGGACAGG - Intergenic
1177398603 21:20571039-20571061 GTGCAAGGCCACCACTGGGAAGG - Intergenic
1178677216 21:34641494-34641516 CTGCCTGGGCACCATAGTAAAGG + Intergenic
1180180985 21:46118605-46118627 CGGCCAGGGTCCCCCTGGAAGGG - Exonic
1180594259 22:16963209-16963231 CACCAAGGGCACCCCTGGAAAGG - Intronic
1181790205 22:25259446-25259468 TTGCTAGCACACCACTGGAAGGG - Intergenic
1181826019 22:25516458-25516480 TTGCTAGCACACCACTGGAAGGG - Intergenic
1184741570 22:46431618-46431640 CTGGAAGGGCACAACAGGAAGGG + Intronic
1184890340 22:47375299-47375321 CTGGCAGGGAACCCCTGGGAGGG + Intergenic
1185220590 22:49627413-49627435 CTGCCTGGGAAAAACTGGAAAGG - Intronic
950544110 3:13628822-13628844 CTCCCAGGGCCACACTGGGAGGG - Intronic
952451748 3:33439995-33440017 CTGCGGGGGCCCCACTGGCAGGG + Exonic
955088002 3:55721670-55721692 CTGCCAGGGCTCCCCTGGGGAGG + Intronic
961454679 3:127018098-127018120 CAGCCAGGGCACCACTGGCATGG - Intronic
963743860 3:149106678-149106700 CTTCCAGGGCACTAATTGAAAGG - Intergenic
966194289 3:177298036-177298058 GTCCCATGGCACCACGGGAAAGG - Intergenic
967540894 3:190666547-190666569 CTGCCTGGGAAACATTGGAAGGG - Intergenic
968800670 4:2741550-2741572 CTGCCAGGGCACCAAGACAAGGG - Intergenic
969684951 4:8666234-8666256 CTGCCTGCTCACCACTGGACTGG + Intergenic
970156842 4:13150418-13150440 CTGCTTGTGCACCACTGGACTGG - Intergenic
972964621 4:44494151-44494173 CTTCCAGGGAACCACTAGATGGG - Intergenic
973744660 4:53951311-53951333 CTGCCATGGTACCACAGAAAGGG + Intronic
974027629 4:56747715-56747737 CTTCCAGAGCACCACTGAAGTGG - Intergenic
974664048 4:64935431-64935453 TTGCCTGGGCACCACTATAATGG + Intergenic
980723841 4:136732130-136732152 TAGCCAGGACAACACTGGAAAGG - Intergenic
985103817 4:186482895-186482917 GTTCCAGGCCATCACTGGAAGGG + Intronic
985206347 4:187541583-187541605 CTGCGAAGGCTCCACTGGAAAGG + Intergenic
986405878 5:7424492-7424514 GTGCCAGGGCACAACAGGAGGGG - Intronic
987128739 5:14840850-14840872 CTGCAAGGGCATCTATGGAAAGG + Intronic
988632383 5:32944896-32944918 TTGCCTGGGCACCACAGGAGAGG - Intergenic
995661330 5:114486609-114486631 CTGGCTGTGCACTACTGGAAGGG - Intronic
996464484 5:123783439-123783461 GTCCCAGGGCACAAGTGGAAGGG + Intergenic
997711520 5:136008720-136008742 TTCCCAGGGCACAACTGGCATGG + Intergenic
997850453 5:137328145-137328167 GTGCCAGTAAACCACTGGAAGGG + Intronic
998128636 5:139640106-139640128 CTGCCAGGGTGCCACGGGAAGGG - Intergenic
1000636831 5:163654217-163654239 TTCCCAGAGCACCTCTGGAATGG - Intergenic
1005476770 6:26215614-26215636 CAGCCTGGGCAACACTGGAAAGG - Intergenic
1006296788 6:33173386-33173408 CTTCCAGGGCCCCCCTGGGAAGG - Exonic
1006321131 6:33320209-33320231 CTCCCAGGGCCCTAGTGGAATGG - Exonic
1006535581 6:34696531-34696553 CTGCCTGGGCACCACCGACAAGG - Exonic
1006875348 6:37290570-37290592 CAGCCAGGGCCCCATGGGAAAGG - Intronic
1014532818 6:122579247-122579269 GTGTCAGGGCATCAGTGGAAAGG - Intronic
1017643435 6:156516506-156516528 CTGCCAGTGGACCACTGGACAGG - Intergenic
1018031572 6:159845517-159845539 CTGCCTGGGCTGCTCTGGAAAGG + Intergenic
1018178539 6:161200018-161200040 CTGCCAGGGCAACAAGGGGAAGG + Intronic
1018330688 6:162724879-162724901 CTGCCTGGGCACCACAGAGAAGG + Intronic
1019406183 7:885465-885487 CTCCCAGAGCACCGCTGGCAGGG - Intronic
1022514406 7:30966116-30966138 CTGCCAGGGTAGCACTGGTGGGG + Intronic
1024760988 7:52595951-52595973 CTTCCAGGGCACTAATTGAAAGG - Intergenic
1026453757 7:70553358-70553380 TTACCAGGACACCACTGCAAGGG + Intronic
1027470117 7:78563197-78563219 ATGACAGGGCACAACTGAAAAGG + Intronic
1028338035 7:89681946-89681968 CTCTCAGGGCACCATGGGAAAGG - Intergenic
1029589087 7:101495338-101495360 CTTCCAGGGCACCTCTGGCGGGG + Intronic
1030673163 7:112359360-112359382 CTGCCAGGCCATCACTGCATAGG + Intergenic
1031543313 7:123022808-123022830 CTTCCAGGGGAAGACTGGAATGG - Intergenic
1032003426 7:128281651-128281673 CTGCCAGCACACCACTGGGTTGG + Intergenic
1032093323 7:128923034-128923056 CTCCCAGGGCACCCCTGGGCTGG - Intergenic
1032845086 7:135745417-135745439 CTGCCAGGGCACCACTGGAAGGG - Intronic
1033546465 7:142405744-142405766 CATCCAGGGCACAACTGGAATGG - Intergenic
1034359646 7:150483066-150483088 CTCCCAGGGCACCACTGGACAGG - Intergenic
1034379261 7:150675835-150675857 CTCCCAGGGCACCACTAGACAGG - Intergenic
1035198016 7:157239430-157239452 CTGGGAGGGTAACACTGGAAGGG + Intronic
1035523444 8:293299-293321 TAGCCAGGGCACCACAGAAAGGG - Intergenic
1037584138 8:20264914-20264936 CTACCAGGGCACGTGTGGAAAGG + Intronic
1037608759 8:20458967-20458989 CTGCCAGGGGCCTTCTGGAAAGG - Intergenic
1037737932 8:21581800-21581822 CTGCCAGGCCTCCCCTGCAATGG - Intergenic
1041656413 8:60355183-60355205 CTTCCAGGGAACCACTGGACAGG - Intergenic
1044372749 8:91432665-91432687 CTGCACAGGAACCACTGGAAAGG - Intergenic
1049329138 8:142040663-142040685 GTGCCAGGGAATCCCTGGAATGG - Intergenic
1049575735 8:143388849-143388871 CTGCCTGGGGACCCCTGGAGAGG + Intergenic
1051735138 9:20190062-20190084 CTCCCAGGGAACCGCTGGAGAGG - Intergenic
1052474901 9:28946508-28946530 CTTCCAGAGCACCAGGGGAAAGG - Intergenic
1055442916 9:76354203-76354225 CTGCCAGGACACCACGGGTGAGG + Exonic
1057315979 9:93968752-93968774 CTGTCAGGCCACCTCTGGCAGGG - Intergenic
1059413639 9:114149796-114149818 CTCCCAGGCCACCATTGGGAGGG - Intergenic
1060036631 9:120261520-120261542 CTCCCAGGGCTCCCCTGGAGAGG + Intergenic
1060961162 9:127681762-127681784 CTGTCCGGGCACCACTGGGGAGG - Intronic
1061366247 9:130173533-130173555 ATGCCAGGGCACCTCCGGAGAGG - Intronic
1062689871 9:137835885-137835907 CTGCCAGGCCACCACACAAAAGG - Exonic
1185610483 X:1391539-1391561 CTGCCAGGCATCCACCGGAAGGG + Intronic
1187309622 X:18129355-18129377 CTGCCTGTGCACAACTTGAAAGG + Intergenic
1190502851 X:51096655-51096677 CTGCCAGGGCAGCTCAGGATTGG + Intergenic
1195033207 X:100946757-100946779 CTGGCAGGACATCACAGGAAGGG - Intergenic
1195306106 X:103585647-103585669 CTGCCAGCGGAACACTGGAATGG + Intronic
1198229688 X:134677187-134677209 CTCCCAGTGCACAACTGGACAGG - Intronic
1200064853 X:153499468-153499490 CTGCCAGAAAACCTCTGGAAAGG + Intronic
1200415222 Y:2902980-2903002 CTGCCTGGGCACCACAGTGAAGG + Intronic
1202337564 Y:23827412-23827434 ATCCCAGGTCCCCACTGGAAAGG + Intergenic
1202533202 Y:25842659-25842681 ATCCCAGGTCCCCACTGGAAAGG - Intergenic