ID: 1032845087

View in Genome Browser
Species Human (GRCh38)
Location 7:135745418-135745440
Sequence CCTGCCAGGGCACCACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 226}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032845087_1032845095 0 Left 1032845087 7:135745418-135745440 CCTTCCAGTGGTGCCCTGGCAGG 0: 1
1: 0
2: 1
3: 22
4: 226
Right 1032845095 7:135745441-135745463 ACCTGGTATGTGCTGGGACGTGG 0: 1
1: 0
2: 2
3: 17
4: 158
1032845087_1032845093 -7 Left 1032845087 7:135745418-135745440 CCTTCCAGTGGTGCCCTGGCAGG 0: 1
1: 0
2: 1
3: 22
4: 226
Right 1032845093 7:135745434-135745456 TGGCAGGACCTGGTATGTGCTGG 0: 1
1: 1
2: 1
3: 13
4: 188
1032845087_1032845094 -6 Left 1032845087 7:135745418-135745440 CCTTCCAGTGGTGCCCTGGCAGG 0: 1
1: 0
2: 1
3: 22
4: 226
Right 1032845094 7:135745435-135745457 GGCAGGACCTGGTATGTGCTGGG 0: 1
1: 0
2: 2
3: 30
4: 275
1032845087_1032845097 1 Left 1032845087 7:135745418-135745440 CCTTCCAGTGGTGCCCTGGCAGG 0: 1
1: 0
2: 1
3: 22
4: 226
Right 1032845097 7:135745442-135745464 CCTGGTATGTGCTGGGACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032845087 Original CRISPR CCTGCCAGGGCACCACTGGA AGG (reversed) Intronic
900081826 1:864253-864275 CTAGCCAGGGCACCACAGAAAGG + Intergenic
900634708 1:3657291-3657313 CATGCCTGGGAACCACAGGATGG - Intronic
901025450 1:6276622-6276644 GCCGCCAGGGCACATCTGGAGGG + Intronic
901037038 1:6342482-6342504 CCTGCCTGGGCAACACAGCAAGG - Intronic
902968896 1:20032470-20032492 CCTGCCAGGGCAAGACTGACTGG - Intronic
904755817 1:32767991-32768013 GCTGACAGTGCAGCACTGGAGGG - Intronic
904760127 1:32797174-32797196 CCTGCCTGGGCAACACAGGGAGG + Intronic
905308187 1:37033301-37033323 CCTGCCCGGGCCGCACTGGGCGG + Intronic
905616780 1:39406820-39406842 CATGCCAGGGCCCCTCTGGTTGG - Intronic
905798781 1:40830340-40830362 ACCTCCAGGGCACCACTGCATGG + Intronic
905909396 1:41643507-41643529 GGTGTCAGGGCAACACTGGAAGG - Intronic
907344495 1:53763525-53763547 CCTGGCAGAGAAACACTGGAAGG - Intergenic
914982351 1:152425879-152425901 CCTTCCAGGGCAACACTGAGAGG + Intergenic
915106418 1:153537483-153537505 CCTGCCCTCGCACCACTGCATGG + Intronic
915395985 1:155584469-155584491 CCAGCCTGGGCACCATAGGAAGG + Intergenic
915804323 1:158828708-158828730 CCTGCCAGGGCACCACATAATGG - Intergenic
919459379 1:197858159-197858181 CCTCCCAGGGCTGCTCTGGAGGG + Intergenic
922115355 1:222607914-222607936 TCTGCTAGGGCACCACAGAAGGG - Intergenic
922218629 1:223540849-223540871 TCTGCCATCGCACCACTGCAGGG - Intronic
1064228286 10:13506501-13506523 CCTGCTAGGGCACCACATGCAGG + Intronic
1069530807 10:69217993-69218015 CCAGCCTGGGCAAGACTGGATGG + Intergenic
1072734385 10:97869208-97869230 ACTTCCAGGGCATCACGGGAGGG + Exonic
1072896050 10:99367840-99367862 CCTGCCCAGACACCACTTGAAGG + Intronic
1073006253 10:100327243-100327265 CCTGACAGAGCACCATGGGAAGG + Intronic
1074051444 10:109884448-109884470 CCTGGCAGGTCACCACTAGGCGG - Intronic
1075915490 10:126162689-126162711 CAGGCCAGGACACAACTGGATGG + Intronic
1076562162 10:131374039-131374061 CCTGCCCAGGCCCCACTGAAAGG + Intergenic
1076607748 10:131700522-131700544 CCTGCCAGGACGGCACTGTAAGG - Intergenic
1077413770 11:2415123-2415145 CCGGCCAGGGGACCGCAGGAGGG - Exonic
1078709083 11:13773062-13773084 CCTGCTAAGGCACATCTGGAAGG - Intergenic
1078946207 11:16071156-16071178 CCTGCCTGGCTACCAGTGGAAGG - Intronic
1078946230 11:16071298-16071320 CCTGCCTGGCTACCAGTGGAGGG - Intronic
1079009296 11:16815160-16815182 CCTGCCAGGTCAGCACTGGTGGG - Intronic
1079335133 11:19564459-19564481 CCTGCCAGAGCCCGACTGGGTGG - Intronic
1079355551 11:19727469-19727491 CTTCCCAGGGCACCAGTGGGAGG + Intronic
1080492400 11:32780242-32780264 CCAGCCTGGGCAACACAGGAAGG + Intronic
1084282575 11:68108051-68108073 GCTGACGGGGCTCCACTGGAGGG + Intronic
1084533200 11:69741429-69741451 CCTTCCAGGGAACATCTGGAGGG + Intergenic
1085932350 11:81098675-81098697 CATGCGAGGGCATCACTAGAAGG - Intergenic
1091334131 11:134753951-134753973 CCTACCAGGGGACCGCTGAAAGG - Intergenic
1091518642 12:1212816-1212838 CCTCCCAGGGCACCGCTGGCTGG + Intronic
1092118862 12:6029623-6029645 CCTGCCACTGCACCCCTGCAGGG + Intronic
1094118160 12:26939000-26939022 CCTGCGAGTTCACCACCGGACGG + Intronic
1096580119 12:52579711-52579733 GCTACCAGGGCAGCCCTGGAGGG - Intergenic
1096652573 12:53069102-53069124 CCTGCCTGGGCACGACGGGGCGG + Intronic
1100667150 12:96767582-96767604 CCTGCCAGGAAAGGACTGGAAGG - Intronic
1103613403 12:122137685-122137707 CCTGCCTGGGCAGCTCTGGCTGG - Intronic
1107255952 13:38427170-38427192 CCTACAACGGCTCCACTGGATGG - Intergenic
1112509472 13:99997289-99997311 CCTGGCAGGGGAGCACTAGAGGG + Intergenic
1113758002 13:112827487-112827509 CCTGCCACCGCACCACCGGGAGG + Intronic
1114214974 14:20650460-20650482 CGTGCCTGGCCACCACTGGTAGG - Intergenic
1119903659 14:78282564-78282586 CCTGCCAGGGCTCTGATGGATGG - Intronic
1122299842 14:100725355-100725377 CCTGCCAGGGCTGGACTAGAGGG + Intergenic
1122409806 14:101520084-101520106 CCTGGGACGGCAGCACTGGAAGG + Intergenic
1125853196 15:42923718-42923740 CTTGCCAGGGGAACACTGCATGG - Intergenic
1126108695 15:45163210-45163232 CCTGACCAGGGACCACTGGAGGG + Intronic
1128114048 15:65094439-65094461 CCTGCCAGGGCCCCAGGGGATGG - Intronic
1128213266 15:65916850-65916872 CCTGCCACTGCACCCCTGGCTGG - Exonic
1128252099 15:66170895-66170917 CCCACCAGGGCACCACTCGGAGG + Intronic
1128252190 15:66171334-66171356 CTTGCCCTGGCACCACTGGTGGG - Intronic
1128300963 15:66566022-66566044 CCTGCCCGGCCCCCACTGAATGG - Intergenic
1129600014 15:76993374-76993396 CCAGCCAGGGCAGCCCCGGATGG - Intronic
1129609833 15:77044414-77044436 CTTGCCTGGGAACCACTAGAAGG - Exonic
1131092587 15:89633605-89633627 CCTGCCTGGGCTCCCCTGGCTGG + Intronic
1132219991 15:100098227-100098249 CCCTCCAGGTCACTACTGGATGG - Intronic
1132261056 15:100425208-100425230 CCTACCAGGGCACTACTGAGTGG + Intronic
1132584330 16:699782-699804 CCTGCCACAGCCTCACTGGAAGG + Intronic
1132873031 16:2124034-2124056 GCTGCTGGGGCACCACTGGGTGG + Intronic
1132896993 16:2233863-2233885 CCTGCTGGGGAACCACAGGAAGG - Exonic
1133748118 16:8702733-8702755 CATATCAGGGGACCACTGGAAGG + Intronic
1133864222 16:9626793-9626815 CCTGCAAGGGAGACACTGGATGG + Intergenic
1133976097 16:10600803-10600825 CCTGCCAGGGCTTCTCTGAAAGG - Intergenic
1134062210 16:11206049-11206071 CCTGTCTGGCCACCACCGGATGG + Intergenic
1134392057 16:13829292-13829314 GCTGCAAGGGTACCAGTGGAAGG - Intergenic
1134552119 16:15143213-15143235 GCTGCTGGGGCACCACTGGGTGG + Intergenic
1134776723 16:16859627-16859649 CCCGCAAGGGAACCACTGCAAGG - Intergenic
1135881851 16:26265234-26265256 CCGCCCTGGGCACCAGTGGAAGG + Intergenic
1136058104 16:27705871-27705893 CCAGCCTGGGCACCACAGCAAGG - Intronic
1137688547 16:50403680-50403702 CATGCCAGGGCACCATGGGCTGG - Intergenic
1137693836 16:50448180-50448202 GGTGCAAGGGCACCACTGCAGGG - Intergenic
1138430165 16:56963286-56963308 CCCCCCAGGGCACCAGGGGATGG - Intronic
1139682524 16:68576149-68576171 ACAGCCAGGCAACCACTGGAAGG + Intergenic
1141342679 16:83217654-83217676 CCTGACAGGGCAACAGTGGGGGG + Intronic
1141478413 16:84289495-84289517 GCAGCCAGGGCTCCAATGGATGG - Intergenic
1141879227 16:86846798-86846820 CCTGCCAGTGGACCAGTGGATGG + Intergenic
1142141617 16:88475240-88475262 CCTGCCAGGTGCCCACTGCATGG - Intronic
1143542324 17:7576855-7576877 ACTGCCAGGGCTGCACTGGCAGG - Intronic
1143894574 17:10126060-10126082 CCTGCCAGGGACCCACAGCAGGG + Intronic
1145112000 17:20172140-20172162 CCTGCCCTGGCACCTGTGGAAGG + Intronic
1145233128 17:21189508-21189530 CATGGCAGGACAGCACTGGAGGG - Intronic
1145858155 17:28182492-28182514 CCTGCCATTTCAGCACTGGAAGG - Intronic
1146794483 17:35771776-35771798 TCTGCCAGGGCACCTCTGGGGGG + Intronic
1148720294 17:49747716-49747738 CCGGGCAGGGAACCACTAGATGG - Intronic
1148807363 17:50270709-50270731 CCTGCCGGGGCCCAGCTGGAAGG - Intergenic
1149481674 17:57008512-57008534 CCTGCCCGGACAGCAATGGAAGG - Intergenic
1151008917 17:70471374-70471396 ACTGCCAGGTCACCACTTGTTGG + Intergenic
1151086816 17:71389714-71389736 CCTTCCAGGGAACCACTCAAGGG - Intergenic
1151319067 17:73342047-73342069 CCTGCCTGGAGACCACAGGATGG + Intronic
1151499895 17:74481876-74481898 TGTGCCAGGGCACCCCTGGGAGG + Intronic
1151714491 17:75824404-75824426 CCTGCAGGGTCACGACTGGAGGG - Exonic
1152718079 17:81909402-81909424 CTTGCCAGGGCACAGCTGTAGGG - Intronic
1153619038 18:6959252-6959274 CCGCCCAGGGCACCACCGCAAGG + Intronic
1154486569 18:14876285-14876307 CCTGCAAGGGCAAAACTTGATGG + Intergenic
1156389017 18:36633361-36633383 ACTGCCAGGCCATCACTTGATGG + Intronic
1160378587 18:78431748-78431770 CCAGCCTGGGCACTACTGAATGG + Intergenic
1160434695 18:78838357-78838379 CCCACCAGGGCCCCACTGGGAGG - Intergenic
1160532776 18:79575256-79575278 CCTGCCAGGTGACCTCTGCAAGG + Intergenic
1160869449 19:1270364-1270386 CTGCCCAGGGCACAACTGGAAGG + Intronic
1161084776 19:2329797-2329819 GCAGCCAGGTCACAACTGGACGG - Intronic
1161374279 19:3931205-3931227 CCTGGCAGGGCACCTCTGGGAGG - Intergenic
1161377985 19:3950007-3950029 CCTGCCTGGGAGGCACTGGAGGG + Intergenic
1161542635 19:4861245-4861267 CCTGCCAGGGCACCCTGGGGTGG + Intronic
1162370324 19:10274907-10274929 CCTGCCTGGGAACAACCGGAAGG + Exonic
1163419587 19:17206563-17206585 CTTGCCTGGGCACCACAGGGTGG + Intronic
1163531780 19:17854174-17854196 CTCGCCTGGGCCCCACTGGATGG + Intergenic
1163693606 19:18751026-18751048 CCTGCCAGGCCCCCACTCCAAGG - Intronic
1164418659 19:28067587-28067609 TCTGCCATGGAGCCACTGGATGG - Intergenic
1164558512 19:29271493-29271515 GGGGTCAGGGCACCACTGGATGG - Intergenic
1165447481 19:35864549-35864571 CCTGCCTGGCCTCCACTGGCTGG + Intronic
1166144431 19:40824347-40824369 CCAGCCAGGGCAACACAGCAAGG + Intronic
1166210682 19:41304856-41304878 GCTGCCAGGAGACCAATGGATGG + Intronic
1167688888 19:50973289-50973311 CCAGCCAGGCCACCAAGGGATGG - Intergenic
1168554586 19:57327372-57327394 CCTGCCAGGGCAACAGTGGGAGG - Intronic
925061994 2:898485-898507 ACTGTCATGGCACCAGTGGAGGG + Intergenic
926325853 2:11784801-11784823 CGTGCCAGAGCATCACTGGATGG + Intronic
927311220 2:21633766-21633788 CCTGCAAGGACACCACTGTAGGG + Intergenic
927702754 2:25278191-25278213 CCTGTCAGGGCCACACTGGAAGG - Intronic
928168805 2:28990317-28990339 CCTTCCAAGGCCCCACTTGAGGG + Intronic
929559868 2:42949501-42949523 CCTGCCACTGCAGCACTTGATGG - Intergenic
929668361 2:43851304-43851326 CCTGTCAGGCCACCACTGGCTGG + Intronic
930136061 2:47905437-47905459 CCTTCCCGGGCACCGCGGGAAGG - Intronic
931718964 2:65053516-65053538 CATGCCAGGGCACAAGTTGATGG + Intergenic
933789404 2:85872072-85872094 CCTGCCTGGACACCACAGTAGGG - Intronic
934716994 2:96550166-96550188 CCTGCAAGGGCACCTCGTGAGGG - Exonic
937127540 2:119484019-119484041 CCTGCCAGGGCTCCCTGGGAAGG - Intronic
939368435 2:141265380-141265402 CCTTCCAGGGCAGCAGTTGAAGG - Intronic
941910836 2:170763251-170763273 CCAGCCAGGGCAACACAGGAAGG + Intergenic
941970625 2:171347055-171347077 CCTGTCAGGGGACCACTGCAGGG - Intronic
942925331 2:181425549-181425571 ACTGCCTGGCCATCACTGGATGG - Intergenic
944160315 2:196652724-196652746 TCTGCTAGGGCAGCACTGAAGGG - Intronic
945378570 2:209110897-209110919 CCTGATAGGGCACAAGTGGAAGG - Intergenic
946578832 2:221104673-221104695 CCTGCCACGTCAACACTGGCCGG + Intergenic
947829062 2:233125965-233125987 CCAGCCAGGGCAGGGCTGGATGG + Intronic
948122867 2:235543880-235543902 CCTGTCAGGGAATCACGGGATGG + Intronic
949047049 2:241877032-241877054 CCTGCCAGGCCACCTCTGGCTGG + Intergenic
1170978619 20:21189893-21189915 CCTTCCAGGGGGCCACTTGAAGG - Intronic
1172132275 20:32663871-32663893 CCTGCCCGGGGCCCTCTGGAGGG + Intergenic
1173280596 20:41623567-41623589 GCTGCCATGCCACCCCTGGACGG - Intergenic
1173421367 20:42904334-42904356 CCTGACAGGACACCACAGGCAGG + Intronic
1173576666 20:44116386-44116408 CCTGCCAGGGCAACACAGGGAGG + Exonic
1173729635 20:45319212-45319234 CCTGGCAGGGCAGTAGTGGAGGG - Intergenic
1174297703 20:49560881-49560903 CGTGGCAGGGATCCACTGGAGGG + Intronic
1175850073 20:62085575-62085597 CCTGCCAGTTCTCCTCTGGACGG + Intergenic
1176794732 21:13363090-13363112 CCTGCAAGGGCAAAACTTGATGG - Intergenic
1176867708 21:14063183-14063205 CCTGCCCACCCACCACTGGAGGG - Intergenic
1179719265 21:43306198-43306220 CCTGCCCAGTCACCACTGCAAGG + Intergenic
1179909257 21:44439245-44439267 CCTGCCCCAGCACCACTGGGTGG + Intronic
1180501640 22:15935081-15935103 AATGCCAGGGCACCTCTGGTAGG - Intergenic
1181134184 22:20752570-20752592 CCTACCAGGGGACCTCTGGCTGG + Intronic
1183246106 22:36694694-36694716 CCTGCTAGGACTCCCCTGGAGGG + Intronic
1183297291 22:37037791-37037813 CCCTCCAGGGCTGCACTGGAAGG - Intergenic
1183297292 22:37037791-37037813 CCTTCCAGTGCAGCCCTGGAGGG + Intergenic
1183505599 22:38207055-38207077 CCTGCCAGGGCCACACAGGGAGG + Intronic
1184459416 22:44628555-44628577 CCTGCCAGGGCACCACCATTTGG - Intergenic
1184644231 22:45887767-45887789 CCTCCCTGGGCACCACCTGATGG + Intergenic
1184890339 22:47375298-47375320 CCTGGCAGGGAACCCCTGGGAGG + Intergenic
1184918127 22:47587213-47587235 CCTGGCACAGCACAACTGGAAGG - Intergenic
950544111 3:13628823-13628845 CCTCCCAGGGCCACACTGGGAGG - Intronic
950882756 3:16336350-16336372 CCTCCATGGGCTCCACTGGATGG - Intronic
953955179 3:47226550-47226572 CCAGCCAAGTCACCCCTGGAGGG - Intergenic
955097920 3:55818131-55818153 CCTTCCAGGACAGCTCTGGAAGG - Intronic
957038545 3:75317532-75317554 CCAGCCAGGGCACTTCTGAAAGG + Intergenic
961086574 3:124072830-124072852 CCAGCCAGGGCACTTCTGAAAGG + Intergenic
964641972 3:158918119-158918141 TCTTACAGGACACCACTGGAAGG + Intergenic
967445677 3:189563896-189563918 CCTACAAGGGCACTCCTGGAAGG + Intergenic
968522491 4:1040231-1040253 CCTGGCAGGGCCTCACTGGCAGG + Intergenic
968917405 4:3502578-3502600 CTAGCCAGGGCACCACGGGTGGG + Intergenic
968982131 4:3855958-3855980 CCTGCCAGGGCAACAGTTGAAGG - Intergenic
969260006 4:6027443-6027465 CCTGCCACACCCCCACTGGATGG - Intronic
969696788 4:8739532-8739554 CCCGCCAGGGCCACACTGGAAGG - Intergenic
972964622 4:44494152-44494174 TCTTCCAGGGAACCACTAGATGG - Intergenic
974851753 4:67412397-67412419 CCGGGCAGGGCACCTCTGAATGG - Intergenic
976246989 4:83014175-83014197 GCTGTTGGGGCACCACTGGAAGG + Intergenic
981080902 4:140638034-140638056 ACTGCCTGTTCACCACTGGAGGG - Intronic
984141730 4:176012385-176012407 CCTCCCAGTGCCCCACTGCAGGG + Intergenic
986405879 5:7424493-7424515 TGTGCCAGGGCACAACAGGAGGG - Intronic
986605553 5:9520068-9520090 CCAGCCATGGCACCTCAGGAAGG + Intronic
995402626 5:111759071-111759093 CCAGCCAGGGAAGTACTGGAAGG + Intronic
998128637 5:139640107-139640129 ACTGCCAGGGTGCCACGGGAAGG - Intergenic
998779593 5:145641663-145641685 CCTGTCAGGGCCCCCCTGGGGGG - Intronic
1001227338 5:169956165-169956187 CCTGCAAGGGCAAAACTTGATGG + Intronic
1001683736 5:173577307-173577329 CCTGCCAGGTTACCACAGGTAGG - Intergenic
1002182040 5:177435668-177435690 CCTGCCAGGGCAGCCCTGTGGGG - Intronic
1003129933 6:3386757-3386779 CCACCCAGGGCACCACTGGAAGG + Intronic
1003380964 6:5624399-5624421 CCTGCCAGGACAGCACTGAAGGG - Intronic
1003460022 6:6320599-6320621 CACGCGAGGGCACCTCTGGAGGG - Exonic
1003483812 6:6557121-6557143 CCAGCCAGGGAGCCACTAGAGGG + Intergenic
1004153030 6:13138762-13138784 GCTCCAAGGTCACCACTGGAAGG - Intronic
1006067820 6:31475040-31475062 CCTGCCAAGGCACTGGTGGATGG - Intergenic
1007622580 6:43224008-43224030 CCTCCCAGAGCATCAGTGGAAGG + Intronic
1011340447 6:86307685-86307707 CCTGCCAGGGAACCCCAGAATGG + Intergenic
1017446420 6:154510600-154510622 CCTGCCAGGGCGGCACGGGAGGG - Exonic
1017700093 6:157061007-157061029 CCTGCTGTGGCACCTCTGGATGG + Intronic
1022514405 7:30966115-30966137 CCTGCCAGGGTAGCACTGGTGGG + Intronic
1025942996 7:66087326-66087348 CCTGCAATGGCCCCACTGCAGGG - Exonic
1028359985 7:89955880-89955902 CCTACCAGGGCACCACCTAATGG - Intergenic
1029588804 7:101493324-101493346 CCTGCCAGGCAAACACTGAAGGG - Intronic
1029589086 7:101495337-101495359 GCTTCCAGGGCACCTCTGGCGGG + Intronic
1031961164 7:127991249-127991271 CATCCCAGGCCACCAGTGGAGGG - Intronic
1032463749 7:132130449-132130471 CCTTCCAGGGCCGCCCTGGAGGG - Exonic
1032845087 7:135745418-135745440 CCTGCCAGGGCACCACTGGAAGG - Intronic
1034737421 7:153441780-153441802 CATGCCAGGACACAACTAGAAGG - Intergenic
1034941610 7:155234271-155234293 TCAGTCAGGGCTCCACTGGAGGG + Intergenic
1035198015 7:157239429-157239451 CCTGGGAGGGTAACACTGGAAGG + Intronic
1035359294 7:158299803-158299825 CCTGCCAGGGCTTCCCTGGGGGG - Intronic
1035523445 8:293300-293322 CTAGCCAGGGCACCACAGAAAGG - Intergenic
1035535101 8:384951-384973 CCTCCCAGGGCTGCACTGTAGGG - Intergenic
1036371061 8:8163243-8163265 ACTGCCAGGAGACCACAGGAAGG - Intergenic
1036879836 8:12502393-12502415 ACTGCCAGGAGACCACAGGAAGG + Intergenic
1037813096 8:22098170-22098192 CCTGCCAGGCCCCAGCTGGACGG + Exonic
1038321549 8:26531818-26531840 CCTGAAAGGACACCACTGGTTGG + Intronic
1039448016 8:37648173-37648195 CTTCCCAGAGCACCCCTGGACGG + Intergenic
1040416352 8:47199125-47199147 CCTGCCACTGCACCACAGCATGG - Intergenic
1041312786 8:56533638-56533660 CATGGCAGGGCAGCAATGGAGGG + Intergenic
1043294908 8:78650240-78650262 TCTGCATGGGGACCACTGGATGG - Intergenic
1045998684 8:108394028-108394050 AGTGCCAGAGCCCCACTGGAGGG + Intronic
1047957072 8:129984310-129984332 CCTGCCTGGGAGACACTGGATGG - Intronic
1048857494 8:138697155-138697177 CCTTCCAGGGGGCCCCTGGAGGG - Intronic
1052343385 9:27384691-27384713 CATGCCAGGGAAATACTGGAGGG - Intronic
1053667016 9:40323752-40323774 AGTGCCAGGGCACTACTGGGAGG + Intronic
1054378163 9:64463780-64463802 AGTGCCAGGGCACTACTGGGAGG + Intergenic
1054517594 9:66052531-66052553 AGTGCCAGGGCACTACTGGGAGG - Intergenic
1057858632 9:98622635-98622657 CGAGACAGGGCACCACAGGAAGG - Intronic
1058734483 9:107881839-107881861 CCTCCCAGGGCACCAATCCATGG + Intergenic
1059016426 9:110521370-110521392 CCTGCCATGGCACCACATCAGGG - Intronic
1061444159 9:130628376-130628398 CCAGCCAGGGGGCCACTGGTGGG + Intronic
1061868799 9:133509216-133509238 CCTGCCAGGCCACCTCTCCATGG - Intergenic
1062446469 9:136597407-136597429 CCTGGCCGGGCCCCACTGGGTGG + Intergenic
1185610482 X:1391538-1391560 CCTGCCAGGCATCCACCGGAAGG + Intronic
1187333373 X:18360983-18361005 ACTGACAGGGGACCACTGGCTGG + Intergenic
1189241124 X:39525504-39525526 CCTGCCTGGGCACCATTGAAAGG + Intergenic
1190326667 X:49210790-49210812 CTTGCCAGGGAAGAACTGGAGGG + Intronic
1190503186 X:51099195-51099217 CGATCAAGGGCACCACTGGATGG + Intergenic
1192543884 X:71996920-71996942 CCTGGCAGGGCAAGACGGGAAGG - Intergenic
1195033208 X:100946758-100946780 CCTGGCAGGACATCACAGGAAGG - Intergenic
1195136004 X:101907403-101907425 CCTGCCCGGGAATCTCTGGATGG + Intronic
1195418087 X:104641965-104641987 GCTGCCAGGAGACCACGGGAGGG - Intronic
1196765527 X:119238248-119238270 CCAGCCTGGGCAACACAGGAGGG - Intronic
1197310699 X:124901672-124901694 CCAGCCTGGGCAACACTGGGGGG - Intronic
1199474098 X:148227252-148227274 CCTGCCAGGGCCCAACTTGCAGG + Intergenic