ID: 1032847039

View in Genome Browser
Species Human (GRCh38)
Location 7:135759935-135759957
Sequence GGTTGGAGTCACCATTATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032847039_1032847045 5 Left 1032847039 7:135759935-135759957 CCACAATAATGGTGACTCCAACC No data
Right 1032847045 7:135759963-135759985 CTTTGGGAGTTCAGTCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032847039 Original CRISPR GGTTGGAGTCACCATTATTG TGG (reversed) Intergenic
No off target data available for this crispr