ID: 1032847995

View in Genome Browser
Species Human (GRCh38)
Location 7:135768294-135768316
Sequence CATGGAAGGCAGAGCTTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032847990_1032847995 -1 Left 1032847990 7:135768272-135768294 CCTGCAATCCTTAGGGTGGGGAC No data
Right 1032847995 7:135768294-135768316 CATGGAAGGCAGAGCTTAAAGGG No data
1032847992_1032847995 -9 Left 1032847992 7:135768280-135768302 CCTTAGGGTGGGGACATGGAAGG No data
Right 1032847995 7:135768294-135768316 CATGGAAGGCAGAGCTTAAAGGG No data
1032847987_1032847995 1 Left 1032847987 7:135768270-135768292 CCCCTGCAATCCTTAGGGTGGGG No data
Right 1032847995 7:135768294-135768316 CATGGAAGGCAGAGCTTAAAGGG No data
1032847989_1032847995 0 Left 1032847989 7:135768271-135768293 CCCTGCAATCCTTAGGGTGGGGA No data
Right 1032847995 7:135768294-135768316 CATGGAAGGCAGAGCTTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032847995 Original CRISPR CATGGAAGGCAGAGCTTAAA GGG Intergenic
No off target data available for this crispr