ID: 1032850249

View in Genome Browser
Species Human (GRCh38)
Location 7:135788871-135788893
Sequence CCACGGTGTTTGGCTGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032850244_1032850249 -5 Left 1032850244 7:135788853-135788875 CCCAGGGTTTAGAGAGGGCCACG No data
Right 1032850249 7:135788871-135788893 CCACGGTGTTTGGCTGATTCTGG No data
1032850245_1032850249 -6 Left 1032850245 7:135788854-135788876 CCAGGGTTTAGAGAGGGCCACGG No data
Right 1032850249 7:135788871-135788893 CCACGGTGTTTGGCTGATTCTGG No data
1032850239_1032850249 14 Left 1032850239 7:135788834-135788856 CCATAGGATGGGAGTCTGGCCCA No data
Right 1032850249 7:135788871-135788893 CCACGGTGTTTGGCTGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032850249 Original CRISPR CCACGGTGTTTGGCTGATTC TGG Intergenic
No off target data available for this crispr