ID: 1032850550

View in Genome Browser
Species Human (GRCh38)
Location 7:135791546-135791568
Sequence GGAAATGCACAGATTCATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032850550_1032850555 3 Left 1032850550 7:135791546-135791568 CCTAGATGAATCTGTGCATTTCC No data
Right 1032850555 7:135791572-135791594 CCTTGTGCACAGAAGTCCCAGGG No data
1032850550_1032850553 2 Left 1032850550 7:135791546-135791568 CCTAGATGAATCTGTGCATTTCC No data
Right 1032850553 7:135791571-135791593 TCCTTGTGCACAGAAGTCCCAGG No data
1032850550_1032850556 18 Left 1032850550 7:135791546-135791568 CCTAGATGAATCTGTGCATTTCC No data
Right 1032850556 7:135791587-135791609 TCCCAGGGCCAGCAAACCATTGG No data
1032850550_1032850559 22 Left 1032850550 7:135791546-135791568 CCTAGATGAATCTGTGCATTTCC No data
Right 1032850559 7:135791591-135791613 AGGGCCAGCAAACCATTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032850550 Original CRISPR GGAAATGCACAGATTCATCT AGG (reversed) Intergenic
No off target data available for this crispr