ID: 1032855446

View in Genome Browser
Species Human (GRCh38)
Location 7:135829948-135829970
Sequence ATAAAATCAAGACTACGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032855440_1032855446 4 Left 1032855440 7:135829921-135829943 CCCACCTTGTCAGGGGTTGGGTG No data
Right 1032855446 7:135829948-135829970 ATAAAATCAAGACTACGGCTGGG No data
1032855434_1032855446 27 Left 1032855434 7:135829898-135829920 CCTGGTGGTATGCAAAGCTTATG No data
Right 1032855446 7:135829948-135829970 ATAAAATCAAGACTACGGCTGGG No data
1032855443_1032855446 0 Left 1032855443 7:135829925-135829947 CCTTGTCAGGGGTTGGGTGGATA No data
Right 1032855446 7:135829948-135829970 ATAAAATCAAGACTACGGCTGGG No data
1032855441_1032855446 3 Left 1032855441 7:135829922-135829944 CCACCTTGTCAGGGGTTGGGTGG No data
Right 1032855446 7:135829948-135829970 ATAAAATCAAGACTACGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032855446 Original CRISPR ATAAAATCAAGACTACGGCT GGG Intergenic
No off target data available for this crispr