ID: 1032859229

View in Genome Browser
Species Human (GRCh38)
Location 7:135861807-135861829
Sequence GGGCATCACGACAGCAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032859229_1032859234 10 Left 1032859229 7:135861807-135861829 CCATGGCTGCTGTCGTGATGCCC No data
Right 1032859234 7:135861840-135861862 CTGCCTCTTTTCTTTGTGTGTGG No data
1032859229_1032859236 21 Left 1032859229 7:135861807-135861829 CCATGGCTGCTGTCGTGATGCCC No data
Right 1032859236 7:135861851-135861873 CTTTGTGTGTGGAGACCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032859229 Original CRISPR GGGCATCACGACAGCAGCCA TGG (reversed) Intergenic
No off target data available for this crispr