ID: 1032859233

View in Genome Browser
Species Human (GRCh38)
Location 7:135861828-135861850
Sequence AAAAGAGGCAGAGCATCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032859233_1032859237 12 Left 1032859233 7:135861828-135861850 CCTAGGGATGCTCTGCCTCTTTT No data
Right 1032859237 7:135861863-135861885 AGACCTGAAGGACTTTCCTAAGG No data
1032859233_1032859236 0 Left 1032859233 7:135861828-135861850 CCTAGGGATGCTCTGCCTCTTTT No data
Right 1032859236 7:135861851-135861873 CTTTGTGTGTGGAGACCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032859233 Original CRISPR AAAAGAGGCAGAGCATCCCT AGG (reversed) Intergenic
No off target data available for this crispr