ID: 1032859237

View in Genome Browser
Species Human (GRCh38)
Location 7:135861863-135861885
Sequence AGACCTGAAGGACTTTCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032859235_1032859237 -3 Left 1032859235 7:135861843-135861865 CCTCTTTTCTTTGTGTGTGGAGA No data
Right 1032859237 7:135861863-135861885 AGACCTGAAGGACTTTCCTAAGG No data
1032859233_1032859237 12 Left 1032859233 7:135861828-135861850 CCTAGGGATGCTCTGCCTCTTTT No data
Right 1032859237 7:135861863-135861885 AGACCTGAAGGACTTTCCTAAGG No data
1032859232_1032859237 13 Left 1032859232 7:135861827-135861849 CCCTAGGGATGCTCTGCCTCTTT No data
Right 1032859237 7:135861863-135861885 AGACCTGAAGGACTTTCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032859237 Original CRISPR AGACCTGAAGGACTTTCCTA AGG Intergenic
No off target data available for this crispr