ID: 1032859546

View in Genome Browser
Species Human (GRCh38)
Location 7:135864178-135864200
Sequence CCAGTGTCACACTGCACTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032859546_1032859550 2 Left 1032859546 7:135864178-135864200 CCCTGAGTGCAGTGTGACACTGG No data
Right 1032859550 7:135864203-135864225 CAGATCTGTGAAGGAGCTGCTGG No data
1032859546_1032859549 -7 Left 1032859546 7:135864178-135864200 CCCTGAGTGCAGTGTGACACTGG No data
Right 1032859549 7:135864194-135864216 ACACTGGCACAGATCTGTGAAGG No data
1032859546_1032859551 8 Left 1032859546 7:135864178-135864200 CCCTGAGTGCAGTGTGACACTGG No data
Right 1032859551 7:135864209-135864231 TGTGAAGGAGCTGCTGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032859546 Original CRISPR CCAGTGTCACACTGCACTCA GGG (reversed) Intergenic
No off target data available for this crispr