ID: 1032859822

View in Genome Browser
Species Human (GRCh38)
Location 7:135866319-135866341
Sequence CATGGTGATGATGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032859822_1032859831 -4 Left 1032859822 7:135866319-135866341 CCCTCCTCCTCATCATCACCATG No data
Right 1032859831 7:135866338-135866360 CATGCATTGTCCGGGGCCTTGGG No data
1032859822_1032859830 -5 Left 1032859822 7:135866319-135866341 CCCTCCTCCTCATCATCACCATG No data
Right 1032859830 7:135866337-135866359 CCATGCATTGTCCGGGGCCTTGG No data
1032859822_1032859832 -3 Left 1032859822 7:135866319-135866341 CCCTCCTCCTCATCATCACCATG No data
Right 1032859832 7:135866339-135866361 ATGCATTGTCCGGGGCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032859822 Original CRISPR CATGGTGATGATGAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr