ID: 1032863001

View in Genome Browser
Species Human (GRCh38)
Location 7:135899255-135899277
Sequence CCTGGTTTGTCCCCTGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032863001_1032863005 4 Left 1032863001 7:135899255-135899277 CCTGGAGCAGGGGACAAACCAGG No data
Right 1032863005 7:135899282-135899304 TGCCAAAGGATCTTCCCATCTGG No data
1032863001_1032863003 -10 Left 1032863001 7:135899255-135899277 CCTGGAGCAGGGGACAAACCAGG No data
Right 1032863003 7:135899268-135899290 ACAAACCAGGTTGCTGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032863001 Original CRISPR CCTGGTTTGTCCCCTGCTCC AGG (reversed) Intergenic
No off target data available for this crispr