ID: 1032866390

View in Genome Browser
Species Human (GRCh38)
Location 7:135929546-135929568
Sequence AAAGGCCAACTCTACATATT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032866390_1032866394 19 Left 1032866390 7:135929546-135929568 CCAAATATGTAGAGTTGGCCTTT 0: 1
1: 0
2: 2
3: 4
4: 136
Right 1032866394 7:135929588-135929610 ACAATCTAATAAATTAGCTAGGG 0: 1
1: 0
2: 0
3: 18
4: 316
1032866390_1032866395 30 Left 1032866390 7:135929546-135929568 CCAAATATGTAGAGTTGGCCTTT 0: 1
1: 0
2: 2
3: 4
4: 136
Right 1032866395 7:135929599-135929621 AATTAGCTAGGGAGCTGAAAAGG 0: 1
1: 0
2: 0
3: 13
4: 175
1032866390_1032866393 18 Left 1032866390 7:135929546-135929568 CCAAATATGTAGAGTTGGCCTTT 0: 1
1: 0
2: 2
3: 4
4: 136
Right 1032866393 7:135929587-135929609 CACAATCTAATAAATTAGCTAGG 0: 1
1: 0
2: 4
3: 112
4: 3163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032866390 Original CRISPR AAAGGCCAACTCTACATATT TGG (reversed) Exonic
902423499 1:16300874-16300896 AAAGGCCAATTCTAGCTTTTTGG - Intronic
910475589 1:87602701-87602723 AAAAGACAAAGCTACATATTTGG + Intergenic
913722138 1:121607505-121607527 AAGGGACTATTCTACATATTAGG - Intergenic
913741923 1:121855085-121855107 AAGGGACTATTCTACATATTAGG - Intergenic
921349136 1:214217773-214217795 CAAAGCCACCTGTACATATTGGG + Intergenic
921542569 1:216434059-216434081 AAAGGGCCACTCTGCATGTTGGG + Intergenic
921827020 1:219683770-219683792 AAAGGCCAACTTAACAAATTAGG + Intergenic
924844253 1:247749710-247749732 ACAGGCCAACTCCACAGACTAGG + Intergenic
1068134585 10:52939509-52939531 AGAGGCCAATTCAAGATATTAGG + Intergenic
1069351755 10:67534699-67534721 AAAGGCCAACTCCAGATTCTGGG + Intronic
1069759897 10:70801664-70801686 AGAGGCCAACTGTAGATACTAGG + Intergenic
1074516159 10:114172415-114172437 AAAGGACAACTCTACTTTATGGG + Intronic
1075735272 10:124660925-124660947 ACAGGCAATCACTACATATTGGG + Intronic
1078491613 11:11774630-11774652 AGCTGACAACTCTACATATTAGG - Intergenic
1078838376 11:15054014-15054036 AAAAGCTAACTTTTCATATTAGG + Intronic
1080474798 11:32580325-32580347 AAAGAAAAACTGTACATATTTGG + Intergenic
1081404252 11:42678132-42678154 AAACGCCAACTTGACATTTTGGG + Intergenic
1082125979 11:48431701-48431723 TGAGGACAACTCTGCATATTTGG - Intergenic
1082559565 11:54602558-54602580 CGAGGACAACTCTGCATATTTGG - Intergenic
1084573057 11:69971076-69971098 AAAGGCCAAGAATAAATATTGGG + Intergenic
1087670818 11:101104566-101104588 AAATGTGAACTCTACATAATTGG + Intronic
1090452604 11:126819882-126819904 AAAGTCCAACTCTGAATGTTTGG - Intronic
1091512557 12:1143993-1144015 AAATGATAACACTACATATTTGG - Intronic
1093829974 12:23743866-23743888 AAGGGTCAACTGTATATATTTGG + Intronic
1094797091 12:33987041-33987063 TAAGGCAAACCCTACATAGTAGG - Intergenic
1095109836 12:38281062-38281084 TAAGGCAAACCCTACATAGTAGG - Intergenic
1095995211 12:48076625-48076647 AAAAGCAAAAACTACATATTGGG - Intronic
1099166921 12:79318177-79318199 AGAGGCCAACTTTGGATATTAGG + Intronic
1099348272 12:81530788-81530810 AAAAGAAATCTCTACATATTTGG + Intronic
1104351888 12:128051377-128051399 ATAGGCAAACACTACAGATTGGG + Intergenic
1104498206 12:129260634-129260656 AGAGACAAACACTACATATTGGG - Intronic
1106220078 13:27739408-27739430 AAGGGTCAACTATATATATTAGG + Intergenic
1106344845 13:28866029-28866051 AAAGGCCAAGTATTCATACTTGG + Intronic
1106444198 13:29810052-29810074 AAAGGCCCACTGTATATTTTAGG + Intronic
1107293139 13:38880257-38880279 AAAGCACAACTCTATTTATTAGG - Intronic
1107852054 13:44580194-44580216 AAAGGGCAACTCTACAGTTAGGG + Intergenic
1107895554 13:44959038-44959060 AAAGGGAAAATCCACATATTTGG + Intronic
1108941933 13:55966094-55966116 AAATGCCAACATTACATAATGGG + Intergenic
1110693629 13:78461143-78461165 GAAGGCCAACTCTACCCAATTGG - Intergenic
1110865738 13:80393567-80393589 AAATGCCACATCTACATTTTTGG - Intergenic
1111122732 13:83876342-83876364 AAGGGCCACCAATACATATTTGG + Intergenic
1111975239 13:94960063-94960085 AAAGGCCAACTCTAAACCTTGGG + Intergenic
1112766639 13:102752758-102752780 AAAGGCCACGTCTACAAATATGG - Intronic
1113088390 13:106592065-106592087 AAGGGTCAACTCTACAAATCCGG - Intergenic
1113109836 13:106811490-106811512 AAAGTCAAAATTTACATATTGGG - Intergenic
1113645696 13:111993833-111993855 TAAAGCCAACTCTCCATCTTGGG + Intergenic
1115132428 14:30069664-30069686 AAATGCCAACTTTTCTTATTTGG + Intronic
1116491896 14:45514321-45514343 AAAGGCCAAGAATACACATTGGG + Intergenic
1116694411 14:48153937-48153959 ATAGGCCAACTGTATATGTTTGG - Intergenic
1116799589 14:49429163-49429185 AAAGGCCACCTGGACATTTTTGG + Intergenic
1117648877 14:57881766-57881788 AAACCCCAAATCTACATAGTAGG - Intronic
1117683899 14:58233319-58233341 AAGGGTCAACTGTACTTATTAGG - Intronic
1118469065 14:66057653-66057675 AAAGGCCAGCTCTGCTAATTTGG + Intergenic
1119062640 14:71491828-71491850 AAATGCCAACTCTTCATGTGGGG - Intronic
1119608862 14:76044753-76044775 AAAGGCCAACTGTAAATATTTGG - Intronic
1119957237 14:78811728-78811750 AAAGCCCAATTCTACTTTTTGGG + Intronic
1121238227 14:92409030-92409052 AAAGCCCAGCTCAACATATATGG - Intronic
1133704999 16:8346004-8346026 AAACGCTAACACTACAGATTTGG + Intergenic
1136273637 16:29164856-29164878 GAATGCCAACTCTGCATTTTTGG + Intergenic
1139526707 16:67521261-67521283 AAAGACCAACTTTACTTCTTAGG + Intronic
1142077176 16:88126601-88126623 GAATGCCAACTCTGCATTTTTGG + Intergenic
1143981464 17:10873810-10873832 AAAGGTCCACTCTGCATCTTTGG - Intergenic
1147116433 17:38303679-38303701 TAAGGCCAACTGTACGTCTTAGG + Intronic
1151175364 17:72283906-72283928 AAAGGCCAGCTCTGCATGTCAGG - Intergenic
1152351637 17:79786832-79786854 CAAGGCCACCTCTTCCTATTTGG - Exonic
1154489430 18:14908392-14908414 ATCAGCCAACTCAACATATTTGG + Intergenic
1157769528 18:50333666-50333688 TAAGGCCAACTCTACACCTCTGG - Intergenic
1165583226 19:36887779-36887801 AATGGCACACTCTACTTATTGGG + Intronic
925504295 2:4543671-4543693 CAAGGCCACTTCCACATATTAGG + Intergenic
928076511 2:28269921-28269943 CTTGGCCAACTATACATATTAGG + Intronic
928916218 2:36474261-36474283 AAAAGACAACCCTACAGATTGGG - Intronic
930172380 2:48264990-48265012 AAAGGCAAACTATACCTACTTGG - Intergenic
931100897 2:58999816-58999838 AAAAGTTAAGTCTACATATTTGG - Intergenic
933077258 2:77944610-77944632 CAAAGCCAATTCTACATGTTTGG + Intergenic
935492799 2:103741141-103741163 ATAGGCCAACTGTCCATATAGGG + Intergenic
937138405 2:119575908-119575930 TAAGGCCACCTCTTCATACTTGG - Intronic
937833468 2:126447364-126447386 AAAGCCAAACTCGACATTTTAGG + Intergenic
939304950 2:140400044-140400066 TAAGGCCATCTCTACATCTAAGG - Intronic
940321399 2:152381015-152381037 AAAAGGAAACTCTACTTATTAGG - Intronic
1169886563 20:10405137-10405159 AAAGCCCTGTTCTACATATTTGG - Exonic
1175449404 20:59049938-59049960 AAAGGCAAACTCCCCATTTTAGG + Intergenic
1177083438 21:16671510-16671532 AAAACCAAACTATACATATTTGG + Intergenic
949521998 3:4865400-4865422 AAAGGCCAACTGTACTATTTTGG - Intronic
954609600 3:51937379-51937401 AAAGGCCAACACTACGCAGTGGG - Intronic
955406998 3:58631792-58631814 AAAGGCCAGCTCTTTATTTTGGG - Intergenic
955606633 3:60711778-60711800 AAAGACCAAATCTGCATGTTTGG + Intronic
959324245 3:104916155-104916177 AAAGGTCAACTCTTCATTTAGGG + Intergenic
959391006 3:105773413-105773435 AAAAGACTACACTACATATTAGG + Intronic
960402257 3:117215573-117215595 AAAGGCCAACGCTGAATATGTGG + Intergenic
962513141 3:136122583-136122605 AAGGGTCAACTGTATATATTAGG + Intronic
963764672 3:149322449-149322471 CATGGCCAAATCTACATACTGGG + Intronic
964746460 3:160017176-160017198 AACAGCAAAGTCTACATATTTGG + Intronic
965560433 3:170057162-170057184 ATAGCCCAACTATACTTATTTGG - Intronic
966361733 3:179137347-179137369 AAAGGCCAAACCTATATATAGGG + Intergenic
967338630 3:188372041-188372063 ACAGGCTAACTCCACATCTTTGG - Intronic
968895776 4:3402298-3402320 AAAGGCCTACTCTACACATCAGG - Intronic
969108313 4:4825073-4825095 AAGGGCCAATTCTAAATATCAGG + Intergenic
975453059 4:74552670-74552692 AATAGCCAACTCTGCATGTTTGG - Intergenic
978556627 4:109987869-109987891 AAAGGGCAAATTCACATATTTGG + Intronic
978871085 4:113579027-113579049 AAAGGCAAACTGTACAAATCAGG + Intronic
980904643 4:138936286-138936308 AAATGACAACTTTACATATATGG - Intergenic
987184112 5:15397619-15397641 AAAGACCAAATCTACATGATTGG + Intergenic
987728903 5:21742216-21742238 AAAGGTCAACTGTATATTTTAGG - Intergenic
987880999 5:23746163-23746185 AAATGCAAACTATGCATATTTGG + Intergenic
989432386 5:41371048-41371070 AAATGCAAACTCTTCAAATTAGG - Intronic
990591948 5:57275047-57275069 AATGGGCAAATCTACATATGTGG - Intergenic
993448602 5:88045878-88045900 AAAGGCCAGCTCAATAAATTAGG - Intergenic
993581406 5:89666163-89666185 AAATGCCAACCCTACATTTTAGG - Intergenic
995990215 5:118229517-118229539 TAATGCCAACTCTAGATAGTGGG - Intergenic
998568589 5:143237648-143237670 AAAGGAGAACCCTACATATCAGG + Intergenic
999901762 5:156093259-156093281 AAAGCCCACCACTACATATGTGG - Intronic
1000140387 5:158397602-158397624 AAAGGCCATCTCTCCCTATGGGG + Intergenic
1002033036 5:176444840-176444862 AAAGAAAAACTCTACACATTTGG - Intergenic
1004494820 6:16153753-16153775 AAAGGTCATCCCTACATATGAGG + Intergenic
1005441340 6:25872344-25872366 AAAGGCAAAGGCTACAAATTTGG + Intronic
1009005203 6:57776924-57776946 TAAGGTCAAGTCTACACATTTGG + Intergenic
1010602273 6:77844304-77844326 AAATTCCAAATCTACATTTTAGG - Intronic
1011157423 6:84348589-84348611 AATGGCAAACTCTTCTTATTTGG - Intergenic
1012936894 6:105377816-105377838 TTAGGCCAACTTTACAGATTGGG + Intronic
1014514733 6:122365158-122365180 ACAGGCCAACTCTTCATTTCTGG - Intergenic
1018629030 6:165806219-165806241 TAAGGCAAACTCTTCATCTTGGG + Intronic
1018804505 6:167248499-167248521 AACGGCCAAGTCTTCAGATTTGG + Intergenic
1018825799 6:167407174-167407196 AATGGCCAAGTCTTCAGATTTGG + Intergenic
1020950885 7:14675517-14675539 AAGGGGCAACTCTGTATATTGGG + Intronic
1022427123 7:30279489-30279511 AAAGGCAAGCCCTACATTTTAGG - Intergenic
1022997931 7:35777176-35777198 CACTGCCAACTCAACATATTAGG + Intergenic
1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG + Intronic
1025232501 7:57211915-57211937 AAAGGCCAACCCCACATGCTGGG + Intergenic
1027811703 7:82910013-82910035 AAAGGAAAATTCTATATATTAGG - Intronic
1028838360 7:95398894-95398916 AAAGCCCCACTATACATATAAGG - Intergenic
1030865919 7:114701585-114701607 AAAGCCCAGCTATGCATATTTGG - Intergenic
1032866390 7:135929546-135929568 AAAGGCCAACTCTACATATTTGG - Exonic
1034862903 7:154615347-154615369 ATAGGCCAGCCCTACAGATTAGG + Intronic
1035848762 8:2893303-2893325 TAAGGACAGCTCTACCTATTGGG + Intergenic
1036610487 8:10345815-10345837 AAAGGTCAAATCTACCTTTTAGG + Intronic
1046239828 8:111476030-111476052 AATGGCCAACCTTACATATGTGG - Intergenic
1048976025 8:139673659-139673681 AAATGTCAGCTCTACACATTTGG + Intronic
1052958902 9:34277640-34277662 AAAGGGCATCTCAACATGTTAGG - Intronic
1058160065 9:101560312-101560334 AATGGTTACCTCTACATATTGGG + Intronic
1187733860 X:22284149-22284171 ACAGGGCAACTGTAAATATTAGG - Intergenic
1188578579 X:31682877-31682899 AAAGGCCATCTCTAGATATTAGG + Intronic
1194448951 X:94018501-94018523 AAAGGCCTACTAAACACATTGGG - Intergenic
1198132644 X:133713079-133713101 AATGGACAAATCTACAGATTTGG + Intronic