ID: 1032871495

View in Genome Browser
Species Human (GRCh38)
Location 7:135990905-135990927
Sequence TTTCCATGTTGATGGAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032871495_1032871497 2 Left 1032871495 7:135990905-135990927 CCTGCACTCCATCAACATGGAAA No data
Right 1032871497 7:135990930-135990952 GAAAAACTCACTTTCCTTGTTGG No data
1032871495_1032871499 26 Left 1032871495 7:135990905-135990927 CCTGCACTCCATCAACATGGAAA No data
Right 1032871499 7:135990954-135990976 CGTGAGCGAAACTCCAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032871495 Original CRISPR TTTCCATGTTGATGGAGTGC AGG (reversed) Intergenic
No off target data available for this crispr