ID: 1032879077

View in Genome Browser
Species Human (GRCh38)
Location 7:136069388-136069410
Sequence CAGGGAATGAGAGATACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032879077_1032879082 -4 Left 1032879077 7:136069388-136069410 CCAGCTGTATCTCTCATTCCCTG No data
Right 1032879082 7:136069407-136069429 CCTGCTGTTTGAGGGAAAATTGG No data
1032879077_1032879083 -3 Left 1032879077 7:136069388-136069410 CCAGCTGTATCTCTCATTCCCTG No data
Right 1032879083 7:136069408-136069430 CTGCTGTTTGAGGGAAAATTGGG No data
1032879077_1032879085 25 Left 1032879077 7:136069388-136069410 CCAGCTGTATCTCTCATTCCCTG No data
Right 1032879085 7:136069436-136069458 GATAGTATATCCCAAACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032879077 Original CRISPR CAGGGAATGAGAGATACAGC TGG (reversed) Intergenic
No off target data available for this crispr