ID: 1032879080

View in Genome Browser
Species Human (GRCh38)
Location 7:136069406-136069428
Sequence CAATTTTCCCTCAAACAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032879080_1032879085 7 Left 1032879080 7:136069406-136069428 CCCTGCTGTTTGAGGGAAAATTG No data
Right 1032879085 7:136069436-136069458 GATAGTATATCCCAAACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032879080 Original CRISPR CAATTTTCCCTCAAACAGCA GGG (reversed) Intergenic
No off target data available for this crispr