ID: 1032879085

View in Genome Browser
Species Human (GRCh38)
Location 7:136069436-136069458
Sequence GATAGTATATCCCAAACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032879081_1032879085 6 Left 1032879081 7:136069407-136069429 CCTGCTGTTTGAGGGAAAATTGG No data
Right 1032879085 7:136069436-136069458 GATAGTATATCCCAAACAAATGG No data
1032879077_1032879085 25 Left 1032879077 7:136069388-136069410 CCAGCTGTATCTCTCATTCCCTG No data
Right 1032879085 7:136069436-136069458 GATAGTATATCCCAAACAAATGG No data
1032879080_1032879085 7 Left 1032879080 7:136069406-136069428 CCCTGCTGTTTGAGGGAAAATTG No data
Right 1032879085 7:136069436-136069458 GATAGTATATCCCAAACAAATGG No data
1032879076_1032879085 26 Left 1032879076 7:136069387-136069409 CCCAGCTGTATCTCTCATTCCCT No data
Right 1032879085 7:136069436-136069458 GATAGTATATCCCAAACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032879085 Original CRISPR GATAGTATATCCCAAACAAA TGG Intergenic
No off target data available for this crispr