ID: 1032884395

View in Genome Browser
Species Human (GRCh38)
Location 7:136122541-136122563
Sequence TGTGCGATTTTGGAGTTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032884392_1032884395 1 Left 1032884392 7:136122517-136122539 CCAATGATGATTTTGACTCTATT No data
Right 1032884395 7:136122541-136122563 TGTGCGATTTTGGAGTTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032884395 Original CRISPR TGTGCGATTTTGGAGTTTAT GGG Intergenic
No off target data available for this crispr