ID: 1032885098

View in Genome Browser
Species Human (GRCh38)
Location 7:136128988-136129010
Sequence CAATTTTATTAGCCTGCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032885097_1032885098 -1 Left 1032885097 7:136128966-136128988 CCTAACTTAAACATACTCGGAAC No data
Right 1032885098 7:136128988-136129010 CAATTTTATTAGCCTGCAGTTGG No data
1032885095_1032885098 26 Left 1032885095 7:136128939-136128961 CCTACTGCATATCAAAGCTTAGC No data
Right 1032885098 7:136128988-136129010 CAATTTTATTAGCCTGCAGTTGG No data
1032885094_1032885098 30 Left 1032885094 7:136128935-136128957 CCAGCCTACTGCATATCAAAGCT No data
Right 1032885098 7:136128988-136129010 CAATTTTATTAGCCTGCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032885098 Original CRISPR CAATTTTATTAGCCTGCAGT TGG Intergenic
No off target data available for this crispr