ID: 1032885377

View in Genome Browser
Species Human (GRCh38)
Location 7:136132725-136132747
Sequence TAGAATAATCATGATGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032885377_1032885380 -8 Left 1032885377 7:136132725-136132747 CCTTCATCATCATGATTATTCTA No data
Right 1032885380 7:136132740-136132762 TTATTCTATCTTAGGCAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032885377 Original CRISPR TAGAATAATCATGATGATGA AGG (reversed) Intergenic
No off target data available for this crispr