ID: 1032886727

View in Genome Browser
Species Human (GRCh38)
Location 7:136148322-136148344
Sequence CTGTACAGAGACATTTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032886727_1032886730 4 Left 1032886727 7:136148322-136148344 CCTCCAAAAATGTCTCTGTACAG No data
Right 1032886730 7:136148349-136148371 TTGGTGTCAGAGTGCCTATCAGG No data
1032886727_1032886731 5 Left 1032886727 7:136148322-136148344 CCTCCAAAAATGTCTCTGTACAG No data
Right 1032886731 7:136148350-136148372 TGGTGTCAGAGTGCCTATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032886727 Original CRISPR CTGTACAGAGACATTTTTGG AGG (reversed) Intergenic
No off target data available for this crispr