ID: 1032889619

View in Genome Browser
Species Human (GRCh38)
Location 7:136180640-136180662
Sequence TGGCATGCCAATTATGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032889617_1032889619 0 Left 1032889617 7:136180617-136180639 CCTTATTATCACGTCACAATTTG No data
Right 1032889619 7:136180640-136180662 TGGCATGCCAATTATGTGCCAGG No data
1032889614_1032889619 23 Left 1032889614 7:136180594-136180616 CCTGATTTAATAACCAGCTTTAC No data
Right 1032889619 7:136180640-136180662 TGGCATGCCAATTATGTGCCAGG No data
1032889616_1032889619 1 Left 1032889616 7:136180616-136180638 CCCTTATTATCACGTCACAATTT No data
Right 1032889619 7:136180640-136180662 TGGCATGCCAATTATGTGCCAGG No data
1032889615_1032889619 10 Left 1032889615 7:136180607-136180629 CCAGCTTTACCCTTATTATCACG No data
Right 1032889619 7:136180640-136180662 TGGCATGCCAATTATGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032889619 Original CRISPR TGGCATGCCAATTATGTGCC AGG Intergenic
No off target data available for this crispr