ID: 1032890393

View in Genome Browser
Species Human (GRCh38)
Location 7:136189161-136189183
Sequence CTGCTTCTTGCTTGTTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032890393_1032890399 -10 Left 1032890393 7:136189161-136189183 CCCCCAAAACAAGCAAGAAGCAG No data
Right 1032890399 7:136189174-136189196 CAAGAAGCAGATAGAGTGGTGGG No data
1032890393_1032890401 -2 Left 1032890393 7:136189161-136189183 CCCCCAAAACAAGCAAGAAGCAG No data
Right 1032890401 7:136189182-136189204 AGATAGAGTGGTGGGAGGAGAGG No data
1032890393_1032890403 18 Left 1032890393 7:136189161-136189183 CCCCCAAAACAAGCAAGAAGCAG No data
Right 1032890403 7:136189202-136189224 AGGTAGGAGAGAGTAGAGTCAGG No data
1032890393_1032890405 27 Left 1032890393 7:136189161-136189183 CCCCCAAAACAAGCAAGAAGCAG No data
Right 1032890405 7:136189211-136189233 AGAGTAGAGTCAGGGACATTAGG No data
1032890393_1032890406 28 Left 1032890393 7:136189161-136189183 CCCCCAAAACAAGCAAGAAGCAG No data
Right 1032890406 7:136189212-136189234 GAGTAGAGTCAGGGACATTAGGG No data
1032890393_1032890400 -7 Left 1032890393 7:136189161-136189183 CCCCCAAAACAAGCAAGAAGCAG No data
Right 1032890400 7:136189177-136189199 GAAGCAGATAGAGTGGTGGGAGG No data
1032890393_1032890407 29 Left 1032890393 7:136189161-136189183 CCCCCAAAACAAGCAAGAAGCAG No data
Right 1032890407 7:136189213-136189235 AGTAGAGTCAGGGACATTAGGGG No data
1032890393_1032890404 19 Left 1032890393 7:136189161-136189183 CCCCCAAAACAAGCAAGAAGCAG No data
Right 1032890404 7:136189203-136189225 GGTAGGAGAGAGTAGAGTCAGGG No data
1032890393_1032890402 2 Left 1032890393 7:136189161-136189183 CCCCCAAAACAAGCAAGAAGCAG No data
Right 1032890402 7:136189186-136189208 AGAGTGGTGGGAGGAGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032890393 Original CRISPR CTGCTTCTTGCTTGTTTTGG GGG (reversed) Intergenic
No off target data available for this crispr