ID: 1032890610

View in Genome Browser
Species Human (GRCh38)
Location 7:136191167-136191189
Sequence GTGCCCACCCAGACTGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032890607_1032890610 0 Left 1032890607 7:136191144-136191166 CCATGCTGGCAGCTGATTAGATG 0: 252
1: 472
2: 594
3: 535
4: 521
Right 1032890610 7:136191167-136191189 GTGCCCACCCAGACTGAGGTTGG No data
1032890604_1032890610 28 Left 1032890604 7:136191116-136191138 CCACATTCTTCTGCCTGCTTTAT 0: 20
1: 132
2: 360
3: 520
4: 1079
Right 1032890610 7:136191167-136191189 GTGCCCACCCAGACTGAGGTTGG No data
1032890605_1032890610 15 Left 1032890605 7:136191129-136191151 CCTGCTTTATTCTAGCCATGCTG 0: 62
1: 144
2: 277
3: 243
4: 373
Right 1032890610 7:136191167-136191189 GTGCCCACCCAGACTGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032890610 Original CRISPR GTGCCCACCCAGACTGAGGT TGG Intergenic
No off target data available for this crispr