ID: 1032893070

View in Genome Browser
Species Human (GRCh38)
Location 7:136220609-136220631
Sequence CTCAGCGAGGCTTTTGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032893063_1032893070 19 Left 1032893063 7:136220567-136220589 CCTGAAGGGCTCTGAAGAGACTG No data
Right 1032893070 7:136220609-136220631 CTCAGCGAGGCTTTTGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032893070 Original CRISPR CTCAGCGAGGCTTTTGGGAA GGG Intergenic