ID: 1032893070 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:136220609-136220631 |
| Sequence | CTCAGCGAGGCTTTTGGGAA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1032893063_1032893070 | 19 | Left | 1032893063 | 7:136220567-136220589 | CCTGAAGGGCTCTGAAGAGACTG | No data | ||
| Right | 1032893070 | 7:136220609-136220631 | CTCAGCGAGGCTTTTGGGAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1032893070 | Original CRISPR | CTCAGCGAGGCTTTTGGGAA GGG | Intergenic | ||