ID: 1032895026

View in Genome Browser
Species Human (GRCh38)
Location 7:136240818-136240840
Sequence CAGAATCTTGACTGTTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032895015_1032895026 20 Left 1032895015 7:136240775-136240797 CCCTCCGTCAGCACCTCACCATC No data
Right 1032895026 7:136240818-136240840 CAGAATCTTGACTGTTTTGGAGG No data
1032895016_1032895026 19 Left 1032895016 7:136240776-136240798 CCTCCGTCAGCACCTCACCATCT No data
Right 1032895026 7:136240818-136240840 CAGAATCTTGACTGTTTTGGAGG No data
1032895023_1032895026 2 Left 1032895023 7:136240793-136240815 CCATCTCTCAGGGGGACAAGTGC No data
Right 1032895026 7:136240818-136240840 CAGAATCTTGACTGTTTTGGAGG No data
1032895017_1032895026 16 Left 1032895017 7:136240779-136240801 CCGTCAGCACCTCACCATCTCTC No data
Right 1032895026 7:136240818-136240840 CAGAATCTTGACTGTTTTGGAGG No data
1032895022_1032895026 7 Left 1032895022 7:136240788-136240810 CCTCACCATCTCTCAGGGGGACA No data
Right 1032895026 7:136240818-136240840 CAGAATCTTGACTGTTTTGGAGG No data
1032895014_1032895026 26 Left 1032895014 7:136240769-136240791 CCACTGCCCTCCGTCAGCACCTC No data
Right 1032895026 7:136240818-136240840 CAGAATCTTGACTGTTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032895026 Original CRISPR CAGAATCTTGACTGTTTTGG AGG Intergenic
No off target data available for this crispr