ID: 1032896049

View in Genome Browser
Species Human (GRCh38)
Location 7:136251935-136251957
Sequence GCTGGGTGCAGAAGCATCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032896049_1032896054 24 Left 1032896049 7:136251935-136251957 CCTGAGATGCTTCTGCACCCAGC No data
Right 1032896054 7:136251982-136252004 TGCCTGAAATTCCATTGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032896049 Original CRISPR GCTGGGTGCAGAAGCATCTC AGG (reversed) Intergenic
No off target data available for this crispr